Stem-loop sequence rno-mir-20b

AccessionMI0003554 (change log)
DescriptionRattus norvegicus miR-20b stem-loop
Gene family MIPF0000001; mir-17
Literature search

32 open access papers mention rno-mir-20b
(69 sentences)

Stem-loop
   gu       -           g     g   -  uuu 
5'   agugcca aagugcucaua ugcag uag gu   g
     ||||||| ||||||||||| ||||| ||| ||    
3'   ucauggu uucacgagugu acguc auc ca   c
   -c       c           g     -   u  cgu 
Get sequence
Deep sequencing
2670 reads, 0 reads per million, 341 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chrX: 140117518-140117589 [-]
intergenic
Clustered miRNAs
< 10kb from rno-mir-20b
rno-mir-17-2chrX: 140117891-140117968 [-]
rno-mir-20bchrX: 140117518-140117589 [-]
rno-mir-19b-2chrX: 140117379-140117474 [-]
rno-mir-92a-2chrX: 140117249-140117340 [-]
rno-mir-363chrX: 140117098-140117184 [-]
Database links

Mature sequence rno-miR-20b-5p

Accession MIMAT0003211
Previous IDsrno-miR-20b
Sequence

8 - 

caaagugcucauagugcagguag

 - 30

Get sequence
Deep sequencing1950 reads, 311 experiments
Evidence experimental; SOLiD [3]
Predicted targets

Mature sequence rno-miR-20b-3p

Accession MIMAT0003212
Previous IDsrno-miR-20b*
Sequence

46 - 

acugcagugugagcacuucugg

 - 67

Get sequence
Deep sequencing719 reads, 205 experiments
Evidence experimental; cloned [1-2], SOLiD [3]
Predicted targets

References

1
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).