Stem-loop sequence rno-mir-363

Accession

MI0003553 (change log)

Description

Rattus norvegicus miR-363 stem-loop

Gene family

MIPF0000138; mir-363

Literature search

9 open access papers mention rno-mir-363
(25 sentences)

Stem-loop

         u   au         ca  a         ga  ag g 
5' uuuugc guu  cggguggau  cg ugcaauuuu  uu  a u
   |||||| |||  |||||||||  || |||||||||  ||  |  
3' aggacg caa  gucuaccua  gc acguuaaag  ag  u a
         c   au         ug  -         ag  gg a 

Deep sequencing

24843 reads, 13.3 reads per million, 467 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context

• Coordinates (Rnor_6.0; GCA_000001895.4): chrX: 140117098-140117184 [-]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from rno-mir-363

• rno-mir-17-2: chrX: 140117891-140117968 [-]
• rno-mir-20b: chrX: 140117518-140117589 [-]
• rno-mir-19b-2: chrX: 140117379-140117474 [-]
• rno-mir-92a-2: chrX: 140117249-140117340 [-]
• rno-mir-363: chrX: 140117098-140117184 [-]

Database links

• EntrezGene:Mir363
• miRBase Tracker:MI0003553

Mature sequence rno-miR-363-5p

• Accession: MIMAT0003209
• Previous IDs: rno-miR-363-5p;rno-miR-363*
• Sequence: 13 - cggguggaucacgaugcaauuu - 34
• Deep sequencing: 11 reads, 10 experiments
• Evidence: experimental; SOLiD [3]
• Predicted targets:
  • TargetScanVert:rno-miR-363-5p
  • miRDB:rno-miR-363-5p
  • microrna.org:rno-miR-363-5p

Mature sequence rno-miR-363-3p

• Accession: MIMAT0003210
• Previous IDs: rno-miR-363-3p;rno-miR-363
• Sequence: 56 - aauugcacgguauccaucugu - 76
• Deep sequencing: 24830 reads, 467 experiments
• Evidence: experimental; cloned [1-2], SOLiD [3]
• Predicted targets:
  • TargetScanVert:rno-miR-363-3p
  • miRDB:rno-miR-363-3p
  • microrna.org:rno-miR-363-3p

References

1. PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3. PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).