![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence rno-mir-374 |
||||||
Accession | MI0003552 (change log) | |||||
Description | Rattus norvegicus miR-374 stem-loop | |||||
Gene family | MIPF0000288; mir-374 | |||||
Literature search |
![]()
9 open access papers mention rno-mir-374 | |||||
Stem-loop |
ug au c u 5' cucgga g auaauacaac ugcuaagugu c |||||| | |||||||||| |||||||||| 3' gagccu u uauuauguug acgauucacg u gu au c a |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: high
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
Mature sequence rno-miR-374-5p |
|
Accession | MIMAT0003208 |
Previous IDs | rno-miR-374 |
Sequence |
10 - auauaauacaaccugcuaagug - 31 |
Deep sequencing | 26327 reads, 483 experiments |
Evidence | experimental; cloned [1-3], Northern [2], SOLiD [4] |
Predicted targets |
|
Mature sequence rno-miR-374-3p |
|
Accession | MIMAT0017223 |
Previous IDs | rno-miR-374* |
Sequence |
40 - cuuagcacguuguauuauuauu - 61 |
Deep sequencing | 18596 reads, 472 experiments |
Evidence | experimental; SOLiD [4] |
Predicted targets |
|
References |
|
1 |
PMID:16274478
"Identification of clustered microRNAs using an ab initio prediction method"
BMC Bioinformatics. 6:267(2005).
|
2 | |
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
4 |
PMID:20403161
"Small RNA expression and strain specificity in the rat"
BMC Genomics. 11:249(2010).
|