![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence rno-mir-382 |
||||||||||||||||||||||||||||||||||||||||||||
Accession | MI0003548 (change log) | |||||||||||||||||||||||||||||||||||||||||||
Description | Rattus norvegicus miR-382 stem-loop | |||||||||||||||||||||||||||||||||||||||||||
Gene family | MIPF0000018; mir-154 | |||||||||||||||||||||||||||||||||||||||||||
Literature search |
![]()
10 open access papers mention rno-mir-382 | |||||||||||||||||||||||||||||||||||||||||||
Stem-loop |
u -a ug - uuu 5' gguacu gaagaga guuguucgugg gauucg c a |||||| ||||||| ||||||||||| |||||| | c 3' ccauga cuuuuuu caacaggcacu cuaagc g u - ca ua a ugu |
|||||||||||||||||||||||||||||||||||||||||||
Deep sequencing |
| |||||||||||||||||||||||||||||||||||||||||||
Confidence |
Annotation confidence: high
| |||||||||||||||||||||||||||||||||||||||||||
Genome context |
|
|||||||||||||||||||||||||||||||||||||||||||
Clustered miRNAs |
|
|||||||||||||||||||||||||||||||||||||||||||
Database links |
Mature sequence rno-miR-382-5p |
|
Accession | MIMAT0003201 |
Previous IDs | rno-miR-382 |
Sequence |
13 - gaaguuguucgugguggauucg - 34 |
Deep sequencing | 67458 reads, 403 experiments |
Evidence | experimental; cloned [3], SOLiD [4] |
Predicted targets |
|
Mature sequence rno-miR-382-3p |
|
Accession | MIMAT0003202 |
Previous IDs | rno-miR-382* |
Sequence |
49 - aaucauucacggacaacacuu - 69 |
Deep sequencing | 8421 reads, 295 experiments |
Evidence | experimental; cloned [2], Northern [2], SOLiD [4] |
Predicted targets |
|
References |
|
1 |
PMID:16274478
"Identification of clustered microRNAs using an ab initio prediction method"
BMC Bioinformatics. 6:267(2005).
|
2 | |
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
4 |
PMID:20403161
"Small RNA expression and strain specificity in the rat"
BMC Genomics. 11:249(2010).
|