![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence rno-mir-376a |
||||||||||||||||||||||||||||||||||||||
Accession | MI0003545 (change log) | |||||||||||||||||||||||||||||||||||||
Description | Rattus norvegicus miR-376a stem-loop | |||||||||||||||||||||||||||||||||||||
Gene family | MIPF0000091; mir-368 | |||||||||||||||||||||||||||||||||||||
Literature search |
![]()
9 open access papers mention rno-mir-376a | |||||||||||||||||||||||||||||||||||||
Stem-loop |
u u g a c u guacaaua 5' gauauu aaaa gu gauu uccu cuauga u |||||| |||| || |||| |||| |||||| u 3' cuauga uuuu ca cuaa agga gaugcu a a c g c a - aaucagua |
|||||||||||||||||||||||||||||||||||||
Deep sequencing |
| |||||||||||||||||||||||||||||||||||||
Confidence |
Annotation confidence: high
| |||||||||||||||||||||||||||||||||||||
Genome context |
|
|||||||||||||||||||||||||||||||||||||
Clustered miRNAs |
|
|||||||||||||||||||||||||||||||||||||
Database links |
Mature sequence rno-miR-376a-5p |
|
Accession | MIMAT0003197 |
Previous IDs | rno-miR-376a* |
Sequence |
13 - gguagauucuccuucuaugag - 33 |
Deep sequencing | 14912 reads, 302 experiments |
Evidence | experimental; SOLiD [3] |
Predicted targets |
|
Mature sequence rno-miR-376a-3p |
|
Accession | MIMAT0003198 |
Previous IDs | rno-miR-376a |
Sequence |
51 - aucguagaggaaaauccacgu - 71 |
Deep sequencing | 12048 reads, 261 experiments |
Evidence | experimental; cloned [2], SOLiD [3] |
Predicted targets |
|
References |
|
1 |
PMID:16274478
"Identification of clustered microRNAs using an ab initio prediction method"
BMC Bioinformatics. 6:267(2005).
|
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
3 |
PMID:20403161
"Small RNA expression and strain specificity in the rat"
BMC Genomics. 11:249(2010).
|