Stem-loop sequence rno-mir-376a

AccessionMI0003545 (change log)
DescriptionRattus norvegicus miR-376a stem-loop
Gene family MIPF0000091; mir-368
Literature search

9 open access papers mention rno-mir-376a
(70 sentences)

Stem-loop
   u      u    g  a    c    u      guacaaua 
5'  gauauu aaaa gu gauu uccu cuauga        u
    |||||| |||| || |||| |||| ||||||        u
3'  cuauga uuuu ca cuaa agga gaugcu        a
   a      c    g  c    a    -      aaucagua 
Get sequence
Deep sequencing
27046 reads, 3.25 reads per million, 338 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr6: 133873605-133873686 [+]
antisense
ENSRNOT00000053651 ; Mir3595-201; exon 1
Clustered miRNAs
< 10kb from rno-mir-376a
rno-mir-494chr6: 133864370-133864452 [+]
rno-mir-679chr6: 133864564-133864700 [+]
rno-mir-1193chr6: 133864698-133864817 [+]
rno-mir-666chr6: 133866523-133866621 [+]
rno-mir-543chr6: 133866660-133866739 [+]
rno-mir-495chr6: 133868288-133868367 [+]
rno-mir-667chr6: 133869570-133869661 [+]
rno-mir-376cchr6: 133872439-133872522 [+]
rno-mir-376bchr6: 133873095-133873180 [+]
rno-mir-3595chr6: 133873587-133873706 [-]
rno-mir-376achr6: 133873605-133873686 [+]
rno-mir-300chr6: 133874152-133874230 [+]
rno-mir-381chr6: 133876615-133876675 [+]
rno-mir-487bchr6: 133877124-133877205 [+]
rno-mir-3576chr6: 133877812-133877926 [-]
rno-mir-539chr6: 133877832-133877907 [+]
rno-mir-6331chr6: 133878578-133878700 [+]
rno-mir-544chr6: 133879169-133879246 [+]
Database links

Mature sequence rno-miR-376a-5p

Accession MIMAT0003197
Previous IDsrno-miR-376a*
Sequence

13 - 

gguagauucuccuucuaugag

 - 33

Get sequence
Deep sequencing14912 reads, 302 experiments
Evidence experimental; SOLiD [3]
Predicted targets

Mature sequence rno-miR-376a-3p

Accession MIMAT0003198
Previous IDsrno-miR-376a
Sequence

51 - 

aucguagaggaaaauccacgu

 - 71

Get sequence
Deep sequencing12048 reads, 261 experiments
Evidence experimental; cloned [2], SOLiD [3]
Predicted targets

References

1
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).