![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence rno-mir-376b |
||||||||||||||||||||||||||||||||||||||
Accession | MI0003544 (change log) | |||||||||||||||||||||||||||||||||||||
Description | Rattus norvegicus miR-376b stem-loop | |||||||||||||||||||||||||||||||||||||
Gene family | MIPF0000091; mir-368 | |||||||||||||||||||||||||||||||||||||
Literature search |
![]()
13 open access papers mention rno-mir-376b | |||||||||||||||||||||||||||||||||||||
Stem-loop |
u u a u cgug u 5' uugguauu aaaagguggau uuccu cuaugguua cu c |||||||| ||||||||||| ||||| ||||||||| || 3' aacuauga uuuuucaccua aagga gauacuaau gg c a c c - ---a u |
|||||||||||||||||||||||||||||||||||||
Deep sequencing |
| |||||||||||||||||||||||||||||||||||||
Confidence |
Annotation confidence: high
| |||||||||||||||||||||||||||||||||||||
Genome context |
|
|||||||||||||||||||||||||||||||||||||
Clustered miRNAs |
|
|||||||||||||||||||||||||||||||||||||
Database links |
Mature sequence rno-miR-376b-5p |
|
Accession | MIMAT0003195 |
Previous IDs | rno-miR-376b* |
Sequence |
16 - guggauauuccuucuaugguua - 37 |
Deep sequencing | 30575 reads, 350 experiments |
Evidence | experimental; cloned [2-3], SOLiD [4] |
Predicted targets |
|
Mature sequence rno-miR-376b-3p |
|
Accession | MIMAT0003196 |
Previous IDs | rno-miR-376b |
Sequence |
53 - aucauagaggaacauccacuu - 73 |
Deep sequencing | 116338 reads, 358 experiments |
Evidence | experimental; cloned [2], SOLiD [4] |
Predicted targets |
|
References |
|
1 |
PMID:16274478
"Identification of clustered microRNAs using an ab initio prediction method"
BMC Bioinformatics. 6:267(2005).
|
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
3 |
PMID:17805466
"Cloning and identification of novel microRNAs from rat hippocampus"
Acta Biochim Biophys Sin (Shanghai). 39:708-714(2007).
|
4 |
PMID:20403161
"Small RNA expression and strain specificity in the rat"
BMC Genomics. 11:249(2010).
|