![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence rno-mir-379 |
||||||||||||||||||||||||||||||
Accession | MI0003541 (change log) | |||||||||||||||||||||||||||||
Description | Rattus norvegicus miR-379 stem-loop | |||||||||||||||||||||||||||||
Gene family | MIPF0000126; mir-379 | |||||||||||||||||||||||||||||
Literature search |
![]()
5 open access papers mention rno-mir-379 | |||||||||||||||||||||||||||||
Stem-loop |
u uuc c g a ga - uua 5' gg cug agag uggu gacuaug acguagg cg u || ||| |||| |||| ||||||| ||||||| || g 3' cc gac ucuc auca cugguac uguaucc gu u a uau - a c aa a cuu |
|||||||||||||||||||||||||||||
Deep sequencing |
| |||||||||||||||||||||||||||||
Confidence |
Annotation confidence: high
| |||||||||||||||||||||||||||||
Genome context |
|
|||||||||||||||||||||||||||||
Clustered miRNAs |
|
|||||||||||||||||||||||||||||
Database links |
Mature sequence rno-miR-379-5p |
|
Accession | MIMAT0003192 |
Previous IDs | rno-miR-379 |
Sequence |
16 - ugguagacuauggaacguagg - 36 |
Deep sequencing | 46297 reads, 382 experiments |
Evidence | experimental; cloned [2], SOLiD [3] |
Predicted targets |
|
Mature sequence rno-miR-379-3p |
|
Accession | MIMAT0004791 |
Previous IDs | rno-miR-379* |
Sequence |
52 - cuauguaacaugguccacuaac - 73 |
Deep sequencing | 67556 reads, 400 experiments |
Evidence | experimental; cloned [2], SOLiD [3] |
Predicted targets |
|
References |
|
1 |
PMID:16274478
"Identification of clustered microRNAs using an ab initio prediction method"
BMC Bioinformatics. 6:267(2005).
|
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
3 |
PMID:20403161
"Small RNA expression and strain specificity in the rat"
BMC Genomics. 11:249(2010).
|