Stem-loop sequence rno-mir-542-1

Accession

MI0003528 (change log)

Previous IDs

rno-mir-542

Description

Rattus norvegicus miR-542-1 stem-loop

Gene family

MIPF0000185; mir-542

Literature search

10 open access papers mention rno-mir-542-1
(30 sentences)

Stem-loop

           g c    gg    uca         auacc 
5' ucucagac u ucgg  auca   ugucacgag     a
   |||||||| | ||||  ||||   |||||||||     c
3' agggucug a aguc  uagu   acaguguuc     u
           g a    aa    uag         acgcg 

Deep sequencing

92336 reads, 30.9 reads per million, 485 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context

• Coordinates (Rnor_6.0; GCA_000001895.4): chrX: 158152146-158152224 [+]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from rno-mir-542-1

• rno-mir-322-1: chrX: 158148161-158148255 [+]
• rno-mir-503-1: chrX: 158148476-158148546 [+]
• rno-mir-351-1: chrX: 158149206-158149286 [+]
• rno-mir-542-1: chrX: 158152146-158152224 [+]
• rno-mir-450b-1: chrX: 158153254-158153322 [+]
• rno-mir-450a: chrX: 158153377-158153467 [+]
• rno-mir-542-2: chrX: 158158885-158158963 [+]

Database links

• EntrezGene:Mir542
• miRBase Tracker:MI0003528

Mature sequence rno-miR-542-5p

• Accession: MIMAT0003178
• Sequence: 11 - cucggggaucaucaugucacga - 32
• Deep sequencing: 57324 reads, 453 experiments
• Evidence: experimental; cloned [1-2], SOLiD [3]

Mature sequence rno-miR-542-3p

• Accession: MIMAT0003179
• Sequence: 49 - ugugacagauugauaacugaaa - 70
• Deep sequencing: 219678 reads, 480 experiments
• Evidence: experimental; cloned [2], SOLiD [3]

References

1. PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3. PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).