Stem-loop sequence mmu-mir-542

Accession

MI0003522 (change log)

Symbol

MGI:Mir542

Description

Mus musculus miR-542 stem-loop

Gene family

MIPF0000185; mir-542

Literature search

22 open access papers mention mmu-mir-542
(146 sentences)

Stem-loop

     a        g c    gg    uca         -a   c 
5' gg ucucagac u ucgg  auca   ugucacgag  uac a
   || |||||||| | ||||  ||||   |||||||||  |||  
3' cc agggucug a aguc  uagu   acaguguuc  gug c
     g        g a    aa    uag         cc   u 

Deep sequencing

63839 reads, 185 reads per million, 106 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context

• Coordinates (GRCm38; GCA_000001635.2): chrX: 53049403-53049487 [-]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from mmu-mir-542

• mmu-mir-322: chrX: 53054255-53054349 [-]
• mmu-mir-503: chrX: 53053984-53054054 [-]
• mmu-mir-351: chrX: 53053255-53053353 [-]
• mmu-mir-542: chrX: 53049403-53049487 [-]
• mmu-mir-450a-2: chrX: 53048299-53048367 [-]
• mmu-mir-450a-1: chrX: 53048154-53048244 [-]
• mmu-mir-450b: chrX: 53047997-53048078 [-]

Database links

• EntrezGene:Mir542
• MGI:Mir542
• RNAcentral:URS000069971F_10090
• miRBase Tracker:MI0003522

Mature sequence mmu-miR-542-5p

• Accession: MIMAT0003171
• Sequence: 14 - cucggggaucaucaugucacga - 35
• Deep sequencing: 5706 reads, 96 experiments
• Evidence: experimental; cloned [1,4], miRAP-cloned [3], Illumina [5]
• Database links:
  • RNAcentral:URS00001AF64C_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-542-5p
  • miRDB:mmu-miR-542-5p
  • microrna.org:mmu-miR-542-5p

Mature sequence mmu-miR-542-3p

• Accession: MIMAT0003172
• Sequence: 52 - ugugacagauugauaacugaaa - 73
• Deep sequencing: 58132 reads, 106 experiments
• Evidence: experimental; cloned [1,4], MPSS [2], miRAP-cloned [3], Illumina [5-6]
• Database links:
  • RNAcentral:URS00004F859B_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-542-3p
  • miRDB:mmu-miR-542-3p
  • microrna.org:mmu-miR-542-3p

References

1. PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
2. PMID:16582102 "The expression profile of microRNAs in mouse embryos" Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I Nucleic Acids Res. 34:1765-1771(2006).
3. PMID:16973894 "Mouse microRNA profiles determined with a new and sensitive cloning method" Takada S, Berezikov E, Yamashita Y, Lagos-Quintana M, Kloosterman WP, Enomoto M, Hatanaka H, Fujiwara S, Watanabe H, Soda M, Choi YL, Plasterk RH, Cuppen E, Mano H Nucleic Acids Res. 34:e115(2006).
4. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5. PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
6. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).