![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-539 |
||||||||||||||||||||||||||||||||||||||||||
Accession | MI0003514 (change log) | |||||||||||||||||||||||||||||||||||||||||
Symbol | HGNC:MIR539 | |||||||||||||||||||||||||||||||||||||||||
Description | Homo sapiens miR-539 stem-loop | |||||||||||||||||||||||||||||||||||||||||
Gene family | MIPF0000018; mir-154 | |||||||||||||||||||||||||||||||||||||||||
Literature search |
![]()
27 open access papers mention hsa-mir-539 | |||||||||||||||||||||||||||||||||||||||||
Stem-loop |
ug a g - - uuu 5' auacu aggagaaauu uccuug ugug uucg c a ||||| |||||||||| |||||| |||| |||| | u 3' uauga uuuucuuuaa aggaac auac aagu g u gu c - u a uau |
|||||||||||||||||||||||||||||||||||||||||
Deep sequencing |
| |||||||||||||||||||||||||||||||||||||||||
Confidence |
Annotation confidence: high
| |||||||||||||||||||||||||||||||||||||||||
Genome context |
|
|||||||||||||||||||||||||||||||||||||||||
Clustered miRNAs |
|
|||||||||||||||||||||||||||||||||||||||||
Database links |
|
Mature sequence hsa-miR-539-5p |
|
Accession | MIMAT0003163 |
Previous IDs | hsa-miR-539 |
Sequence |
9 - ggagaaauuauccuuggugugu - 30 |
Deep sequencing | 1545 reads, 90 experiments |
Evidence | experimental; cloned [1,3], miRAP-cloned [2] |
Predicted targets |
|
Mature sequence hsa-miR-539-3p |
|
Accession | MIMAT0022705 |
Sequence |
49 - aucauacaaggacaauuucuuu - 70 |
Deep sequencing | 4555 reads, 102 experiments |
Evidence | not experimental |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:16274478
"Identification of clustered microRNAs using an ab initio prediction method"
BMC Bioinformatics. 6:267(2005).
|
2 |
PMID:16973894
"Mouse microRNA profiles determined with a new and sensitive cloning method"
Nucleic Acids Res. 34:e115(2006).
|
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|