Stem-loop sequence rno-mir-24-1

Accession

MI0000854 (change log)

Description

Rattus norvegicus miR-24-1 stem-loop

Gene family

MIPF0000041; mir-24

Literature search

41 open access papers mention rno-mir-24-1
(194 sentences)

Stem-loop

       g  g   a         ua     ucuca 
5' cucc gu ccu cugagcuga  ucagu     u
   |||| || ||| |||||||||  |||||     u
3' gagg ca gga gacuugacu  gguca     u
       a  a   c         -c     cacac 

Deep sequencing

580423 reads, 362 reads per million, 493 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context

• Coordinates (Rnor_6.0; GCA_000001895.4): chr17: 823968-824035 [+]
• Overlapping transcripts:

  antisense

  ENSRNOT00000053691 ; Mir3074-201; exon 1

Clustered miRNAs

< 10kb from rno-mir-24-1

• rno-mir-23b: chr17: 823222-823318 [+]
• rno-mir-27b: chr17: 823461-823557 [+]
• rno-mir-3074: chr17: 823940-824056 [-]
• rno-mir-24-1: chr17: 823968-824035 [+]

Database links

• EntrezGene:Mir24-1
• miRBase Tracker:MI0000854

Mature sequence rno-miR-24-1-5p

• Accession: MIMAT0003153
• Previous IDs: rno-miR-189;rno-miR-24-1*
• Sequence: 6 - gugccuacugagcugauaucag - 27
• Deep sequencing: 7333 reads, 435 experiments
• Evidence: experimental; cloned [2-3], Northern [2], SOLiD [5]
• Predicted targets:
  • TargetScanVert:rno-miR-24-1-5p
  • miRDB:rno-miR-24-1-5p
  • microrna.org:rno-miR-24-1-5p

Mature sequence rno-miR-24-3p

• Accession: MIMAT0000794
• Previous IDs: rno-miR-24
• Sequence: 44 - uggcucaguucagcaggaacag - 65
• Deep sequencing: 1146242 reads, 492 experiments
• Evidence: experimental; cloned [1-4], Northern [2], SOLiD [5]
• Predicted targets:
  • TargetScanVert:rno-miR-24-3p
  • miRDB:rno-miR-24-3p
  • microrna.org:rno-miR-24-3p

References

1. PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
2. PMID:16766679 "Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes" Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H Genes Dev. 20:1732-1743(2006).
3. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4. PMID:17805466 "Cloning and identification of novel microRNAs from rat hippocampus" He X, Zhang Q, Liu Y, Pan X Acta Biochim Biophys Sin (Shanghai). 39:708-714(2007).
5. PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).