![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-409 |
||||||||||||||||||||||||
Accession | MI0001735 (change log) | |||||||||||||||||||||||
Symbol | HGNC:MIR409 | |||||||||||||||||||||||
Description | Homo sapiens miR-409 stem-loop | |||||||||||||||||||||||
Gene family | MIPF0000018; mir-154 | |||||||||||||||||||||||
Literature search |
![]()
56 open access papers mention hsa-mir-409 | |||||||||||||||||||||||
Stem-loop |
u u gg a ac - - auc 5' gguac cg gag gguu ccgagcaac uuug c u ||||| || ||| |||| ||||||||| |||| | 3' cuaug gc uuc ccaa ggcucguug aagc g g a - uu c gu u a cag |
|||||||||||||||||||||||
Deep sequencing |
| |||||||||||||||||||||||
Confidence |
Annotation confidence: high
| |||||||||||||||||||||||
Comments |
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. The 5' end of the miRNA may be offset with respect to previous annotations. |
|||||||||||||||||||||||
Genome context |
|
|||||||||||||||||||||||
Clustered miRNAs |
|
|||||||||||||||||||||||
Database links |
|
Mature sequence hsa-miR-409-5p |
|
Accession | MIMAT0001638 |
Sequence |
15 - agguuacccgagcaacuuugcau - 37 |
Deep sequencing | 5896 reads, 106 experiments |
Evidence | experimental; cloned [1,3-4] |
Database links |
|
Predicted targets |
|
Mature sequence hsa-miR-409-3p |
|
Accession | MIMAT0001639 |
Sequence |
47 - gaauguugcucggugaaccccu - 68 |
Deep sequencing | 13819 reads, 128 experiments |
Evidence | experimental; cloned [1,3-4], array-cloned [2] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:15891114
"Clustering and conservation patterns of human microRNAs"
Nucleic Acids Res. 33:2697-2706(2005).
|
2 |
PMID:15965474
"Identification of hundreds of conserved and nonconserved human microRNAs"
Nat Genet. 37:766-770(2005).
|
3 |
PMID:16274478
"Identification of clustered microRNAs using an ab initio prediction method"
BMC Bioinformatics. 6:267(2005).
|
4 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|