![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-323b |
||||||||||||||||||||||||||||||||||||||||
Accession | MI0014206 (change log) | |||||||||||||||||||||||||||||||||||||||
Symbol | HGNC:MIR323B | |||||||||||||||||||||||||||||||||||||||
Description | Homo sapiens miR-323b stem-loop | |||||||||||||||||||||||||||||||||||||||
Gene family | MIPF0000018; mir-154 | |||||||||||||||||||||||||||||||||||||||
Literature search |
![]()
47 open access papers mention hsa-mir-323b | |||||||||||||||||||||||||||||||||||||||
Stem-loop |
u u u gugaguuc 5' gguac cggagggagguug ccgug gcauuauu ||||| ||||||||||||| ||||| ||||||| u 3' cuaug gcuuuucuccagc ggcac cguaguaa a - u --auaacc |
|||||||||||||||||||||||||||||||||||||||
Deep sequencing |
| |||||||||||||||||||||||||||||||||||||||
Confidence |
Annotation confidence: high
| |||||||||||||||||||||||||||||||||||||||
Comments |
miR-323b-5p was previously named miR-453 here and in [1,2], but appears to be processed from the same hairpin as miR-332b-3p identified in [3]. Entries for mir-323b and mir-453 are merged here. |
|||||||||||||||||||||||||||||||||||||||
Genome context |
|
|||||||||||||||||||||||||||||||||||||||
Clustered miRNAs |
|
|||||||||||||||||||||||||||||||||||||||
Database links |
|
Mature sequence hsa-miR-323b-5p |
|
Accession | MIMAT0001630 |
Previous IDs | hsa-miR-453 |
Sequence |
15 - agguuguccguggugaguucgca - 37 |
Deep sequencing | 26 reads, 9 experiments |
Evidence | experimental; cloned [1-2] |
Predicted targets |
|
Mature sequence hsa-miR-323b-3p |
|
Accession | MIMAT0015050 |
Sequence |
51 - cccaauacacggucgaccucuu - 72 |
Deep sequencing | 665 reads, 91 experiments |
Evidence | experimental; Illumina [3] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:15891114
"Clustering and conservation patterns of human microRNAs"
Nucleic Acids Res. 33:2697-2706(2005).
|
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
3 |
PMID:20300190
"Characterization of the Melanoma miRNAome by Deep Sequencing"
PLoS One. 5:e9685(2010).
|