![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence rno-mir-449a |
||||||
Accession | MI0001650 (change log) | |||||
Previous IDs | rno-mir-449 | |||||
Description | Rattus norvegicus miR-449a stem-loop | |||||
Gene family | MIPF0000133; mir-449 | |||||
Literature search |
![]()
14 open access papers mention rno-mir-449a | |||||
Stem-loop |
-c uu - u ugaguau 5' ugugugcgauggg ggcagu guau guuagcuggu g ||||||||||||| |||||| |||| |||||||||| 3' auacacguuaucc ucguca cgua caaucgacca u ac uc a - cggaaaa |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: high
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
Mature sequence rno-miR-449a-5p |
|
Accession | MIMAT0001543 |
Previous IDs | rno-miR-449;rno-miR-449a |
Sequence |
16 - uggcaguguauuguuagcuggu - 37 |
Deep sequencing | 45893 reads, 391 experiments |
Evidence | experimental; cloned [1], SOLiD [2] |
Predicted targets |
|
Mature sequence rno-miR-449a-3p |
|
Accession | MIMAT0017181 |
Previous IDs | rno-miR-449a* |
Sequence |
56 - cagcuaacaugcaacugcucuc - 77 |
Deep sequencing | 40 reads, 13 experiments |
Evidence | experimental; SOLiD [2] |
Predicted targets |
|
References |
|
1 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
2 |
PMID:20403161
"Small RNA expression and strain specificity in the rat"
BMC Genomics. 11:249(2010).
|