Stem-loop sequence hsa-mir-423

Accession

MI0001445 (change log)

Symbol

HGNC:MIR423

Description

Homo sapiens miR-423 stem-loop

Gene family

MIPF0000329; mir-423

Literature search

111 open access papers mention hsa-mir-423
(442 sentences)

Stem-loop

   -----auaa       u            -ag   g    a     cua 
5'          aggaagu aggcugaggggc   aga cgag cuuuu   u
            ||||||| ||||||||||||   ||| |||| |||||   u
3'          uccuucg ucugacuccccg   ucu gcuc gaaaa   u
   cgcgcccaa       u            gag   g    -     ccu 

Deep sequencing

1696635 reads, 3.71e+03 reads per million, 159 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

miR-423 (renamed miR-423-3p here) is expressed in human promyelocytic leukemia (HL-60) cells [1]. The level of expression was shown to be up-regulated 48 hours after TPA-induction. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr17: 30117079-30117172 [+]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from hsa-mir-423

• hsa-mir-423: chr17: 30117079-30117172 [+]
• hsa-mir-3184: chr17: 30117086-30117160 [-]

Database links

• EntrezGene:MIR423
• HGNC:MIR423
• RNAcentral:URS000075B951_9606
• miRBase Tracker:MI0001445

Mature sequence hsa-miR-423-5p

• Accession: MIMAT0004748
• Sequence: 17 - ugaggggcagagagcgagacuuu - 39
• Deep sequencing: 1299932 reads, 159 experiments
• Evidence: experimental; cloned [2-4], Northern [4], Illumina [5]
• Database links:
  • RNAcentral:URS00001C8A86_9606
• Predicted targets:
  • TargetMiner:hsa-miR-423-5p
  • TargetScanVert:hsa-miR-423-5p
  • miRDB:hsa-miR-423-5p
  • microrna.org:hsa-miR-423-5p

Mature sequence hsa-miR-423-3p

• Accession: MIMAT0001340
• Previous IDs: hsa-miR-423
• Sequence: 53 - agcucggucugaggccccucagu - 75
• Deep sequencing: 396664 reads, 157 experiments
• Evidence: experimental; cloned [1-2], Northern [1]
• Database links:
  • RNAcentral:URS00000BE495_9606
• Predicted targets:
  • TargetMiner:hsa-miR-423-3p
  • TargetScanVert:hsa-miR-423-3p
  • miRDB:hsa-miR-423-3p
  • microrna.org:hsa-miR-423-3p

References

1. PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3. PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
4. PMID:18230126 "New miRNAs cloned from neuroblastoma" Afanasyeva EA, Hotz-Wagenblatt A, Glatting KH, Westermann F BMC Genomics. 9:52(2008).
5. PMID:20158877 "Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha" Koh W, Sheng CT, Tan B, Lee QY, Kuznetsov V, Kiang LS, Tanavde V BMC Genomics. 11 Suppl 1:S6(2010).