![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence rno-mir-200a |
||||||||||
Accession | MI0000943 (change log) | |||||||||
Description | Rattus norvegicus miR-200a stem-loop | |||||||||
Gene family | MIPF0000019; mir-8 | |||||||||
Literature search |
![]()
67 open access papers mention rno-mir-200a | |||||||||
Stem-loop |
cu - c g - c uu uu 5' ggg c ucu ugggcauc uuaccggacagug ugga uc g ||| | ||| |||||||| ||||||||||||| |||| || g 3' ccc g gga acuuguag aauggucugucac aucu ag c -a a u a c a -c uu |
|||||||||
Deep sequencing |
| |||||||||
Confidence |
Annotation confidence: high
| |||||||||
Genome context |
|
|||||||||
Clustered miRNAs |
|
|||||||||
Database links |
Mature sequence rno-miR-200a-5p |
|
Accession | MIMAT0017151 |
Previous IDs | rno-miR-200a* |
Sequence |
16 - caucuuaccggacagugcugg - 36 |
Deep sequencing | 22977 reads, 297 experiments |
Evidence | experimental; SOLiD [2] |
Predicted targets |
|
Mature sequence rno-miR-200a-3p |
|
Accession | MIMAT0000874 |
Previous IDs | rno-miR-200a |
Sequence |
54 - uaacacugucugguaacgaugu - 75 |
Deep sequencing | 1428279 reads, 484 experiments |
Evidence | experimental; cloned [1], SOLiD [2] |
Predicted targets |
|
References |
|
1 | |
2 |
PMID:20403161
"Small RNA expression and strain specificity in the rat"
BMC Genomics. 11:249(2010).
|