Stem-loop sequence rno-mir-191a

Accession

MI0000934 (change log)

Previous IDs

rno-mir-191

Description

Rattus norvegicus miR-191a stem-loop

Gene family

MIPF0000194; mir-191

Literature search

24 open access papers mention rno-mir-191a
(56 sentences)

Stem-loop

   -   u   c      c          c  aa       uu  -  c 
5'  ggc gga agcggg aacggaaucc aa  gcagcug  gu cu c
    ||| ||| |||||| |||||||||| ||  |||||||  || ||  
3'  ccg ccu ucgucc uugcuuuagg uu  cgucgac  ua ga a
   u   u   c      c          -  ca       cu  c  g 

Deep sequencing

14637440 reads, 1.36e+04 reads per million, 510 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Rnor_6.0; GCA_000001895.4): chr8: 117354364-117354454 [+]
• Overlapping transcripts:

  antisense

  ENSRNOT00000053579 ; Mir3555-201; exon 1

Clustered miRNAs

< 10kb from rno-mir-191a

• rno-mir-191b: chr8: 117354348-117354467 [-]
• rno-mir-191a: chr8: 117354364-117354454 [+]
• rno-mir-425: chr8: 117354821-117354903 [+]

Database links

• EntrezGene:Mir191
• miRBase Tracker:MI0000934

Mature sequence rno-miR-191a-5p

• Accession: MIMAT0000866
• Previous IDs: rno-miR-191
• Sequence: 15 - caacggaaucccaaaagcagcug - 37
• Deep sequencing: 14626000 reads, 510 experiments
• Evidence: experimental; cloned [1-4], Northern [1,3], SOLiD [5]
• Predicted targets:
  • TargetScanVert:rno-miR-191a-5p
  • miRDB:rno-miR-191a-5p
  • microrna.org:rno-miR-191a-5p

Mature sequence rno-miR-191a-3p

• Accession: MIMAT0017146
• Previous IDs: rno-miR-191*
• Sequence: 57 - gcugcacuuggauuucguuccc - 78
• Deep sequencing: 11422 reads, 475 experiments
• Evidence: experimental; SOLiD [5]
• Predicted targets:
  • TargetScanVert:rno-miR-191a-3p
  • miRDB:rno-miR-191a-3p

References

1. PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2. PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
3. PMID:16766679 "Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes" Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H Genes Dev. 20:1732-1743(2006).
4. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5. PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).