![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence rno-mir-107 |
|||||
Accession | MI0000890 (change log) | ||||
Description | Rattus norvegicus miR-107 stem-loop | ||||
Gene family | MIPF0000024; mir-103 | ||||
Literature search |
![]()
29 open access papers mention rno-mir-107 | ||||
Stem-loop |
- c --a u u c u a 5' uucucu ugcuuu agcu cu uacaguguugc uug ggc u |||||| |||||| |||| || ||||||||||| ||| ||| g 3' gagaga acgaaa ucgg ga auguuacgacg aac uug g c c cua - c - - a |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
Mature sequence rno-miR-107-5p |
|
Accession | MIMAT0017115 |
Previous IDs | rno-miR-107* |
Sequence |
15 - agcuucuuuacaguguugccuugu - 38 |
Deep sequencing | 1472 reads, 289 experiments |
Evidence | experimental; SOLiD [2] |
Predicted targets |
|
Mature sequence rno-miR-107-3p |
|
Accession | MIMAT0000826 |
Previous IDs | rno-miR-107 |
Sequence |
52 - agcagcauuguacagggcuauca - 74 |
Deep sequencing | 1984277 reads, 509 experiments |
Evidence | experimental; cloned [1], SOLiD [2] |
Predicted targets |
|
References |
|
1 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
2 |
PMID:20403161
"Small RNA expression and strain specificity in the rat"
BMC Genomics. 11:249(2010).
|