![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence rno-mir-99a |
||||||
Accession | MI0000883 (change log) | |||||
Description | Rattus norvegicus miR-99a stem-loop | |||||
Gene family | MIPF0000033; mir-10 | |||||
Literature search |
![]()
22 open access papers mention rno-mir-99a | |||||
Stem-loop |
cc g a uc u g aag 5' cauug caua acccguaga cga cuugug ug u ||||| |||| ||||||||| ||| |||||| || 3' gugac gugu uggguaucu gcu gaacac gc g gu g c uu c - cag |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: high
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
Mature sequence rno-miR-99a-5p |
|
Accession | MIMAT0000820 |
Previous IDs | rno-miR-99a |
Sequence |
13 - aacccguagauccgaucuugug - 34 |
Deep sequencing | 1936854 reads, 497 experiments |
Evidence | experimental; cloned [1-5], SOLiD [6] |
Predicted targets |
|
Mature sequence rno-miR-99a-3p |
|
Accession | MIMAT0004724 |
Previous IDs | rno-miR-99a* |
Sequence |
50 - caagcucguuucuaugggucug - 71 |
Deep sequencing | 40542 reads, 466 experiments |
Evidence | experimental; cloned [4], SOLiD [6] |
Predicted targets |
|
References |
|
1 |
PMID:14691248
"Identification of many microRNAs that copurify with polyribosomes in mammalian neurons"
Proc Natl Acad Sci U S A. 101:360-365(2004).
|
2 |
PMID:15345052
"Microarray analysis of microRNA expression in the developing mammalian brain"
Genome Biol. 5:R68(2004).
|
3 | |
4 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
5 |
PMID:17805466
"Cloning and identification of novel microRNAs from rat hippocampus"
Acta Biochim Biophys Sin (Shanghai). 39:708-714(2007).
|
6 |
PMID:20403161
"Small RNA expression and strain specificity in the rat"
BMC Genomics. 11:249(2010).
|