Stem-loop sequence rno-mir-34a

AccessionMI0000877 (change log)
DescriptionRattus norvegicus miR-34a stem-loop
Gene family MIPF0000039; mir-34
Literature search

130 open access papers mention rno-mir-34a
(1779 sentences)

Stem-loop 
   c    u   -    a    uu        -   a          --gug   a 
5'  cggc gug agua uucu  ggcagugu cuu gcugguuguu     agu u
    |||| ||| |||| ||||  |||||||| ||| ||||||||||     |||  
3'  guug cac ucgu aaga  ccgucaua gaa cgacuaacga     ucg u
   u    -   g    g    uc        u   -          aggaa   a
Get sequence
Deep sequencing
153474 reads, 107 reads per million, 486 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr5: 167092491-167092592 [+]
intergenic
Database links

Mature sequence rno-miR-34a-5p

Accession MIMAT0000815
Previous IDsrno-miR-34a
Sequence

20 -  

uggcagugucuuagcugguugu

 - 41

Get sequence
Deep sequencing152719 reads, 485 experiments
Evidence experimental; cloned [1-2], SOLiD [3]
Predicted targets

Mature sequence rno-miR-34a-3p

Accession MIMAT0017106
Previous IDsrno-miR-34a*
Sequence

64 -  

aaucagcaaguauacugcccua

 - 85

Get sequence
Deep sequencing660 reads, 182 experiments
Evidence experimental; SOLiD [3]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).