Stem-loop sequence rno-mir-30e

Accession

MI0000867 (change log)

Description

Rattus norvegicus miR-30e stem-loop

Gene family

MIPF0000005; mir-30

Literature search

59 open access papers mention rno-mir-30e
(262 sentences)

Stem-loop

   g        uu  ua            uu           g aaggu 
5'  ggcagucu  gc  cuguaaacaucc  gacuggaagcu u     g
    ||||||||  ||  ||||||||||||  ||||||||||| |      
3'  ccgucgga  cg  gacauuuguagg  cugacuuucga g     u
   a        --  gc            --           g agagu 

Deep sequencing

43943484 reads, 3.5e+04 reads per million, 516 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context

• Coordinates (Rnor_6.0; GCA_000001895.4): chr5: 139702872-139702963 [-]
• Overlapping transcripts:

  sense

  ENSRNOT00000056651 ; Nfyc-201; intron 5

Clustered miRNAs

< 10kb from rno-mir-30e

• rno-mir-30e: chr5: 139702872-139702963 [-]
• rno-mir-30c-1: chr5: 139699877-139699965 [-]

Database links

• EntrezGene:Mir30e
• miRBase Tracker:MI0000867

Mature sequence rno-miR-30e-5p

• Accession: MIMAT0000805
• Previous IDs: rno-miR-30e
• Sequence: 17 - uguaaacauccuugacuggaag - 38
• Deep sequencing: 43193368 reads, 516 experiments
• Evidence: experimental; cloned [1-2], SOLiD [3]
• Predicted targets:
  • TargetScanVert:rno-miR-30e-5p
  • miRDB:rno-miR-30e-5p
  • microrna.org:rno-miR-30e-5p

Mature sequence rno-miR-30e-3p

• Accession: MIMAT0004720
• Previous IDs: rno-miR-30e*
• Sequence: 59 - cuuucagucggauguuuacagc - 80
• Deep sequencing: 749477 reads, 507 experiments
• Evidence: experimental; cloned [2], SOLiD [3]
• Predicted targets:
  • TargetScanVert:rno-miR-30e-3p
  • miRDB:rno-miR-30e-3p
  • microrna.org:rno-miR-30e-3p

References

1. PMID:16766679 "Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes" Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H Genes Dev. 20:1732-1743(2006).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3. PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).