Stem-loop sequence rno-mir-29a

Accession

MI0000863 (change log)

Description

Rattus norvegicus miR-29a stem-loop

Gene family

MIPF0000009; mir-29

Literature search

112 open access papers mention rno-mir-29a
(923 sentences)

Stem-loop

   a    uuagagg            uuu       c    ucaa 
5'  cccc       augacugauuuc   ugguguu agag    u
    ||||       ||||||||||||   ||||||| ||||    a
3'  gggg       uauuggcuaaag   accacga ucuu    g
   a    uuaguaa            ucu       -    uuaa 

Deep sequencing

3521481 reads, 2.36e+03 reads per million, 502 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context

• Coordinates (Rnor_6.0; GCA_000001895.4): chr4: 58343931-58344018 [-]
• Overlapping transcripts:

  antisense

  ENSRNOT00000053581 ; Mir3556a-201; exon 1

Clustered miRNAs

< 10kb from rno-mir-29a

• rno-mir-29b-1: chr4: 58344310-58344390 [-]
• rno-mir-3587: chr4: 58344283-58344345 [+]
• rno-mir-29a: chr4: 58343931-58344018 [-]
• rno-mir-3556a: chr4: 58343919-58344036 [+]

Database links

• EntrezGene:Mir29a
• miRBase Tracker:MI0000863

Mature sequence rno-miR-29a-5p

• Accession: MIMAT0004718
• Previous IDs: rno-miR-29a*
• Sequence: 16 - acugauuucuuuugguguucag - 37
• Deep sequencing: 8040 reads, 445 experiments
• Evidence: experimental; cloned [4], SOLiD [5]
• Predicted targets:
  • TargetScanVert:rno-miR-29a-5p
  • miRDB:rno-miR-29a-5p
  • microrna.org:rno-miR-29a-5p

Mature sequence rno-miR-29a-3p

• Accession: MIMAT0000802
• Previous IDs: rno-miR-29a
• Sequence: 54 - uagcaccaucugaaaucgguua - 75
• Deep sequencing: 3513434 reads, 502 experiments
• Evidence: experimental; cloned [1-4], SOLiD [5]
• Predicted targets:
  • TargetScanVert:rno-miR-29a-3p
  • miRDB:rno-miR-29a-3p
  • microrna.org:rno-miR-29a-3p

References

1. PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2. PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
3. PMID:16766679 "Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes" Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H Genes Dev. 20:1732-1743(2006).
4. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5. PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).