Stem-loop sequence rno-mir-21

AccessionMI0000850 (change log)
DescriptionRattus norvegicus miR-21 stem-loop
Gene family MIPF0000060; mir-21
Literature search

236 open access papers mention rno-mir-21
(2443 sentences)

Stem-loop
   u      ccu      gu        a     a     a    u a 
5'  guacca   ugucgg  agcuuauc gacug uguug cugu g a
    ||||||   ||||||  |||||||| ||||| ||||| |||| | u
3'  uauggu   acaguc  ucggguag cugac acaac ggua c c
   c      uuu      ug        -     g     -    - u 
Get sequence
Deep sequencing
8137692 reads, 8.27e+03 reads per million, 510 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr10: 73902210-73902301 [-]
intergenic
Database links

Mature sequence rno-miR-21-5p

Accession MIMAT0000790
Previous IDsrno-miR-21
Sequence

18 - 

uagcuuaucagacugauguuga

 - 39

Get sequence
Deep sequencing8052247 reads, 510 experiments
Evidence experimental; cloned [1-4], SOLiD [5]
Predicted targets

Mature sequence rno-miR-21-3p

Accession MIMAT0004711
Previous IDsrno-miR-21*
Sequence

56 - 

caacagcagucgaugggcuguc

 - 77

Get sequence
Deep sequencing81822 reads, 498 experiments
Evidence experimental; cloned [3], SOLiD [5]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:17805466 "Cloning and identification of novel microRNAs from rat hippocampus" He X, Zhang Q, Liu Y, Pan X Acta Biochim Biophys Sin (Shanghai). 39:708-714(2007).
5
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).