![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence rno-mir-21 |
|||||
Accession | MI0000850 (change log) | ||||
Description | Rattus norvegicus miR-21 stem-loop | ||||
Gene family | MIPF0000060; mir-21 | ||||
Literature search |
![]()
236 open access papers mention rno-mir-21 | ||||
Stem-loop |
u ccu gu a a a u a 5' guacca ugucgg agcuuauc gacug uguug cugu g a |||||| |||||| |||||||| ||||| ||||| |||| | u 3' uauggu acaguc ucggguag cugac acaac ggua c c c uuu ug - g - - u |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
Mature sequence rno-miR-21-5p |
|
Accession | MIMAT0000790 |
Previous IDs | rno-miR-21 |
Sequence |
18 - uagcuuaucagacugauguuga - 39 |
Deep sequencing | 8052247 reads, 510 experiments |
Evidence | experimental; cloned [1-4], SOLiD [5] |
Predicted targets |
|
Mature sequence rno-miR-21-3p |
|
Accession | MIMAT0004711 |
Previous IDs | rno-miR-21* |
Sequence |
56 - caacagcagucgaugggcuguc - 77 |
Deep sequencing | 81822 reads, 498 experiments |
Evidence | experimental; cloned [3], SOLiD [5] |
Predicted targets |
|
References |
|
1 |
PMID:14691248
"Identification of many microRNAs that copurify with polyribosomes in mammalian neurons"
Proc Natl Acad Sci U S A. 101:360-365(2004).
|
2 | |
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
4 |
PMID:17805466
"Cloning and identification of novel microRNAs from rat hippocampus"
Acta Biochim Biophys Sin (Shanghai). 39:708-714(2007).
|
5 |
PMID:20403161
"Small RNA expression and strain specificity in the rat"
BMC Genomics. 11:249(2010).
|