Stem-loop sequence rno-let-7b

Accession

MI0000829 (change log)

Description

Rattus norvegicus let-7b stem-loop

Gene family

MIPF0000002; let-7

Literature search

108 open access papers mention rno-let-7b
(712 sentences)

Stem-loop

   g     u                     -  -----    ca   a 
5'  cgggg gagguaguagguugugugguu uc     aggg  gug u
    ||||| ||||||||||||||||||||| ||     ||||  |||  
3'  guccc uuccgucauccaacauaucaa ag     uccc  cgc g
   a     -                     u  aagcc    --   u 

Deep sequencing

10848001 reads, 9.31e+03 reads per million, 515 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Rnor_6.0; GCA_000001895.4): chr7: 126590627-126590711 [+]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from rno-let-7b

• rno-let-7c-2: chr7: 126590212-126590306 [+]
• rno-let-7b: chr7: 126590627-126590711 [+]

Database links

• EntrezGene:Mirlet7b
• miRBase Tracker:MI0000829

Mature sequence rno-let-7b-5p

• Accession: MIMAT0000775
• Previous IDs: rno-let-7b
• Sequence: 7 - ugagguaguagguugugugguu - 28
• Deep sequencing: 10781335 reads, 514 experiments
• Evidence: experimental; cloned [1-4], SOLiD [5]
• Predicted targets:
  • TargetScanVert:rno-let-7b-5p
  • miRDB:rno-let-7b-5p
  • microrna.org:rno-let-7b-5p

Mature sequence rno-let-7b-3p

• Accession: MIMAT0004705
• Previous IDs: rno-let-7b*
• Sequence: 61 - cuauacaaccuacugccuuccc - 82
• Deep sequencing: 66550 reads, 489 experiments
• Evidence: experimental; cloned [4], SOLiD [5]
• Predicted targets:
  • TargetScanVert:rno-let-7b-3p
  • miRDB:rno-let-7b-3p
  • microrna.org:rno-let-7b-3p

References

1. PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2. PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
3. PMID:16766679 "Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes" Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H Genes Dev. 20:1732-1743(2006).
4. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5. PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).