Stem-loop sequence rno-let-7a-1

Accession

MI0000827 (change log)

Description

Rattus norvegicus let-7a-1 stem-loop

Gene family

MIPF0000002; let-7

Literature search

113 open access papers mention rno-let-7a-1
(829 sentences)

Stem-loop

   u     g     u   gu                uuagggucacac 
5'  ucacu uggga gag  aguagguuguauaguu            c
    ||||| ||||| |||  ||||||||||||||||            c
3'  agugg auccu uuc  ucaucuaacauaucaa            a
   u     a     -   ug                uagagggucacc 

Deep sequencing

24623325 reads, 2.21e+04 reads per million, 514 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Rnor_6.0; GCA_000001895.4): chr17: 16417853-16417946 [+]
• Overlapping transcripts:

  sense

  ENSRNOT00000053755 ; Mirlet7a-1-201; exon 1

Clustered miRNAs

< 10kb from rno-let-7a-1

• rno-let-7a-1: chr17: 16417853-16417946 [+]
• rno-mir-3596d: chr17: 16418217-16418313 [-]
• rno-let-7f-1: chr17: 16418221-16418309 [+]
• rno-let-7d: chr17: 16419980-16420077 [+]
• rno-mir-3596b: chr17: 16419981-16420075 [-]

Database links

• EntrezGene:Mirlet7a-1
• miRBase Tracker:MI0000827

Mature sequence rno-let-7a-5p

• Accession: MIMAT0000774
• Previous IDs: rno-let-7a
• Sequence: 13 - ugagguaguagguuguauaguu - 34
• Deep sequencing: 49041012 reads, 514 experiments
• Evidence: experimental; cloned [1-4], SOLiD [5]
• Predicted targets:
  • TargetScanVert:rno-let-7a-5p
  • miRDB:rno-let-7a-5p
  • microrna.org:rno-let-7a-5p

Mature sequence rno-let-7a-1-3p

• Accession: MIMAT0017085
• Previous IDs: rno-let-7a-1*
• Sequence: 64 - cuauacaaucuacugucuuucc - 85
• Deep sequencing: 87379 reads, 485 experiments
• Evidence: experimental; SOLiD [5]
• Predicted targets:
  • TargetScanVert:rno-let-7a-1-3p
  • miRDB:rno-let-7a-1-3p

References

1. PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2. PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
3. PMID:16766679 "Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes" Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H Genes Dev. 20:1732-1743(2006).
4. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5. PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).