Stem-loop sequence hsa-mir-345

Accession

MI0000825 (change log)

Symbol

HGNC:MIR345

Description

Homo sapiens miR-345 stem-loop

Gene family

MIPF0000189; mir-345

Literature search

39 open access papers mention hsa-mir-345
(133 sentences)

Stem-loop

   ---------acc       u      g u       a  c         ug u 
5'             caaaccc aggucu c gacuccu gu cagggcucg  a g
               ||||||| |||||| | ||||||| || |||||||||  |  
3'             guuuggg uccgga g cugggga ca gucccgggu  u g
   cgacagcuauaa       -      g u       g  a         gg c 

Deep sequencing

49391 reads, 123 reads per million, 155 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

This sequence is the predicted human homologue [2] of a sequence cloned from rat neuronal tissue [1], later validated in human [3,4]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr14: 100307859-100307956 [+]
• Overlapping transcripts:

  sense

  OTTHUMT00000413938 ; EML1-004; intron 1

  OTTHUMT00000413939 ; EML1-006; intron 1

  OTTHUMT00000413940 ; EML1-003; intron 1

  OTTHUMT00000413941 ; EML1-007; intron 1

  OTTHUMT00000413942 ; EML1-008; intron 1

  OTTHUMT00000413943 ; EML1-001; intron 1

  OTTHUMT00000413944 ; EML1-002; intron 1

  OTTHUMT00000413945 ; EML1-009; intron 1

  OTTHUMT00000413946 ; EML1-010; intron 1

  OTTHUMT00000413947 ; EML1-011; intron 1

  OTTHUMT00000413948 ; EML1-012; intron 1

  ENST00000554479 ; EML1-004; intron 1

  ENST00000555145 ; EML1-006; intron 1

  ENST00000327921 ; EML1-003; intron 1

  ENST00000556199 ; EML1-007; intron 1

  ENST00000556835 ; EML1-008; intron 1

  ENST00000262233 ; EML1-001; intron 1

  ENST00000334192 ; EML1-002; intron 1

  ENST00000555096 ; EML1-009; intron 1

  ENST00000556714 ; EML1-010; intron 1

  ENST00000553720 ; EML1-011; intron 1

  ENST00000556947 ; EML1-012; intron 1

Database links

• EntrezGene:MIR345
• HGNC:MIR345
• RNAcentral:URS000075E1CD_9606
• miRBase Tracker:MI0000825

Mature sequence hsa-miR-345-5p

• Accession: MIMAT0000772
• Previous IDs: hsa-miR-345
• Sequence: 18 - gcugacuccuaguccagggcuc - 39
• Deep sequencing: 48748 reads, 154 experiments
• Evidence: experimental; cloned [3-4], Northern [3]
• Database links:
  • RNAcentral:URS000005D4F5_9606
• Predicted targets:
  • TargetMiner:hsa-miR-345-5p
  • TargetScanVert:hsa-miR-345-5p
  • miRDB:hsa-miR-345-5p
  • microrna.org:hsa-miR-345-5p

Mature sequence hsa-miR-345-3p

• Accession: MIMAT0022698
• Sequence: 54 - gcccugaacgaggggucuggag - 75
• Deep sequencing: 448 reads, 70 experiments
• Evidence: not experimental
• Database links:
  • RNAcentral:URS0000384659_9606
• Predicted targets:
  • TargetMiner:hsa-miR-345-3p
  • TargetScanVert:hsa-miR-345-3p
  • miRDB:hsa-miR-345-3p

References

1. PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2. PMID:15634332 "New human and mouse microRNA genes found by homology search" Weber MJ FEBS J. 272:59-73(2005).
3. PMID:15978578 "Identification of human fetal liver miRNAs by a novel method" Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X FEBS Lett. 579:3849-3854(2005).
4. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).