Stem-loop sequence hsa-mir-324

AccessionMI0000813 (change log)
Symbol HGNC:MIR324
DescriptionHomo sapiens miR-324 stem-loop
Gene family MIPF0000165; mir-324
Literature search

65 open access papers mention hsa-mir-324
(208 sentences)

Stem-loop
   cu      gc     c   u c   a     u   u  aaag 
5'   gacuau  cuccc gca c ccu gggca ugg gu    c
     ||||||  ||||| ||| | ||| ||||| ||| ||     
3'   cugaug  ggggg cgu g gga cccgu acc ca    u
   --      uu     u   c u   c     c   -  gagg 
Get sequence
Deep sequencing
77053 reads, 211 reads per million, 159 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 7223297-7223379 [-]
sense
OTTHUMT00000440693 ; NEURL4-010; intron 1
OTTHUMT00000440668 ; NEURL4-005; intron 20
OTTHUMT00000440657 ; NEURL4-004; intron 20
OTTHUMT00000440658 ; NEURL4-003; intron 20
OTTHUMT00000255435 ; NEURL4-002; intron 21
OTTHUMT00000255434 ; NEURL4-001; intron 21
ENST00000572029 ; NEURL4-010; intron 1
ENST00000573186 ; NEURL4-005; intron 20
ENST00000570460 ; NEURL4-004; intron 20
ENST00000571887 ; NEURL4-003; intron 20
ENST00000315614 ; NEURL4-002; intron 21
ENST00000399464 ; NEURL4-001; intron 21
Database links

Mature sequence hsa-miR-324-5p

Accession MIMAT0000761
Sequence

16 - 

cgcauccccuagggcauuggug

 - 37

Get sequence
Deep sequencing52157 reads, 159 experiments
Evidence experimental; cloned [4-5]
Database links
Predicted targets

Mature sequence hsa-miR-324-3p

Accession MIMAT0000762
Sequence

50 - 

cccacugccccaggugcugcugg

 - 72

Get sequence
Deep sequencing24881 reads, 157 experiments
Evidence experimental; cloned [3-5]
Database links
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
3
PMID:15800047 "Kaposi's sarcoma-associated herpesvirus expresses an array of viral microRNAs in latently infected cells" Cai X, Lu S, Zhang Z, Gonzalez CM, Damania B, Cullen BR Proc Natl Acad Sci U S A. 102:5570-5575(2005).
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).