![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-324 |
|||||
Accession | MI0000813 (change log) | ||||
Symbol | HGNC:MIR324 | ||||
Description | Homo sapiens miR-324 stem-loop | ||||
Gene family | MIPF0000165; mir-324 | ||||
Literature search |
![]()
65 open access papers mention hsa-mir-324 | ||||
Stem-loop |
cu gc c u c a u u aaag 5' gacuau cuccc gca c ccu gggca ugg gu c |||||| ||||| ||| | ||| ||||| ||| || 3' cugaug ggggg cgu g gga cccgu acc ca u -- uu u c u c c - gagg |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-324-5p |
|
Accession | MIMAT0000761 |
Sequence |
16 - cgcauccccuagggcauuggug - 37 |
Deep sequencing | 52157 reads, 159 experiments |
Evidence | experimental; cloned [4-5] |
Database links |
|
Predicted targets |
|
Mature sequence hsa-miR-324-3p |
|
Accession | MIMAT0000762 |
Sequence |
50 - cccacugccccaggugcugcugg - 72 |
Deep sequencing | 24881 reads, 157 experiments |
Evidence | experimental; cloned [3-5] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:14691248
"Identification of many microRNAs that copurify with polyribosomes in mammalian neurons"
Proc Natl Acad Sci U S A. 101:360-365(2004).
|
2 |
PMID:15634332
"New human and mouse microRNA genes found by homology search"
FEBS J. 272:59-73(2005).
|
3 |
PMID:15800047
"Kaposi's sarcoma-associated herpesvirus expresses an array of viral microRNAs in latently infected cells"
Proc Natl Acad Sci U S A. 102:5570-5575(2005).
|
4 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
5 |
PMID:17616659
"Patterns of known and novel small RNAs in human cervical cancer"
Cancer Res. 67:6031-6043(2007).
|