![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-377 |
||||||||||||||||||||||||||||||
Accession | MI0000794 (change log) | |||||||||||||||||||||||||||||
Symbol | MGI:Mir377 | |||||||||||||||||||||||||||||
Description | Mus musculus miR-377 stem-loop | |||||||||||||||||||||||||||||
Gene family | MIPF0000018; mir-154 | |||||||||||||||||||||||||||||
Literature search |
![]()
22 open access papers mention mmu-mir-377 | |||||||||||||||||||||||||||||
Stem-loop |
u c - a - uuu 5' gagcagagguugcc uug guga uucg c a |||||||||||||| ||| |||| |||| | u 3' uuuguuuucaacgg aac cacu aagu g u g a a - u uag |
|||||||||||||||||||||||||||||
Deep sequencing |
| |||||||||||||||||||||||||||||
Confidence |
Annotation confidence: high
| |||||||||||||||||||||||||||||
Genome context |
|
|||||||||||||||||||||||||||||
Clustered miRNAs |
|
|||||||||||||||||||||||||||||
Database links |
|
Mature sequence mmu-miR-377-5p |
|
Accession | MIMAT0017079 |
Previous IDs | mmu-miR-377* |
Sequence |
6 - agagguugcccuuggugaauuc - 27 |
Deep sequencing | 1730 reads, 54 experiments |
Evidence | experimental; Illumina [5] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-377-3p |
|
Accession | MIMAT0000741 |
Previous IDs | mmu-miR-377 |
Sequence |
44 - aucacacaaaggcaacuuuugu - 65 |
Deep sequencing | 30263 reads, 71 experiments |
Evidence | experimental; cloned [1-3], Illumina [4-5] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:15538371
"A pancreatic islet-specific microRNA regulates insulin secretion"
Nature. 432:226-230(2004).
|
2 |
PMID:16274478
"Identification of clustered microRNAs using an ab initio prediction method"
BMC Bioinformatics. 6:267(2005).
|
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
4 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
5 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|