Stem-loop sequence hsa-mir-378a

Accession

MI0000786 (change log)

Previous IDs

hsa-mir-378

Symbol

HGNC:MIR378A

Description

Homo sapiens miR-378a stem-loop

Gene family

MIPF0000168; mir-378

Literature search

212 open access papers mention hsa-mir-378a
(1225 sentences)

Stem-loop

      g  c              ugu      ccu 
5' agg cu cugacuccaggucc   guguua   a
   ||| || ||||||||||||||   ||||||    
3' ucc ga gacugagguucagg   cacgau   g
      g  a              --u      aaa 

Deep sequencing

7611090 reads, 6.01e+03 reads per million, 159 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

miR-422b was the most abundant miRNA cloned from human promyelocytic leukemia (HL-60) cells [2]. The sequence originates from the opposite arm of the human homologue of previously identified mouse mir-378 [1]. Landgraf et al. show that the 3' product (previously called miR-422b) is the predominant one [3]. Further, mir-378 and mir-422a loci are unrelated. miR-422b is thus renamed miR-378 here.

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr5: 149732825-149732890 [+]
• Overlapping transcripts:

  intergenic

Database links

• EntrezGene:MIR378
• HGNC:MIR378A
• RNAcentral:URS00006B86A6_9606
• miRBase Tracker:MI0000786

Mature sequence hsa-miR-378a-5p

• Accession: MIMAT0000731
• Previous IDs: hsa-miR-378;hsa-miR-378*
• Sequence: 5 - cuccugacuccagguccugugu - 26
• Deep sequencing: 13968 reads, 155 experiments
• Evidence: experimental; cloned [3]
• Database links:
  • RNAcentral:URS00004BAA8A_9606
• Predicted targets:
  • TargetMiner:hsa-miR-378a-5p
  • TargetScanVert:hsa-miR-378a-5p
  • miRDB:hsa-miR-378a-5p
  • microrna.org:hsa-miR-378a-5p

Mature sequence hsa-miR-378a-3p

• Accession: MIMAT0000732
• Previous IDs: hsa-miR-422b;hsa-miR-378
• Sequence: 43 - acuggacuuggagucagaaggc - 64
• Deep sequencing: 7597118 reads, 159 experiments
• Evidence: experimental; cloned [2-3], Northern [2]
• Database links:
  • RNAcentral:URS00000451A1_9606
• Predicted targets:
  • TargetMiner:hsa-miR-378a-3p
  • TargetScanVert:hsa-miR-378a-3p
  • miRDB:hsa-miR-378a-3p
  • microrna.org:hsa-miR-378a-3p

References

1. PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
2. PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
3. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).