![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-361 |
|||||
Accession | MI0000761 (change log) | ||||
Symbol | MGI:Mir361 | ||||
Description | Mus musculus miR-361 stem-loop | ||||
Gene family | MIPF0000172; mir-361 | ||||
Literature search |
![]()
20 open access papers mention mmu-mir-361 | ||||
Stem-loop |
uu --u a u agua 5' gaagc aucagaauc cc gggg acuu u ||||| ||||||||| || |||| |||| 3' cuuug uagucuuag gg cccc ugaa u uu ugu a c aagu |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence mmu-miR-361-5p |
|
Accession | MIMAT0000704 |
Previous IDs | mmu-miR-361 |
Sequence |
6 - uuaucagaaucuccagggguac - 27 |
Deep sequencing | 63246 reads, 106 experiments |
Evidence | experimental; cloned [1-2], Illumina [3,5] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-361-3p |
|
Accession | MIMAT0017075 |
Previous IDs | mmu-miR-361* |
Sequence |
43 - ucccccaggugugauucugauuugu - 67 |
Deep sequencing | 10075 reads, 103 experiments |
Evidence | experimental; 454 [4], Illumina [5] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:15538371
"A pancreatic islet-specific microRNA regulates insulin secretion"
Nature. 432:226-230(2004).
|
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
3 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
4 |
PMID:20668074
"Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68"
J Virol. 84:10266-10275(2010).
|
5 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|