Stem-loop sequence mmu-mir-361

AccessionMI0000761 (change log)
Symbol MGI:Mir361
DescriptionMus musculus miR-361 stem-loop
Gene family MIPF0000172; mir-361
Literature search

20 open access papers mention mmu-mir-361
(303 sentences)

Stem-loop
        uu         --u  a    u    agua 
5' gaagc  aucagaauc   cc gggg acuu    u
   |||||  |||||||||   || |||| ||||     
3' cuuug  uagucuuag   gg cccc ugaa    u
        uu         ugu  a    c    aagu 
Get sequence
Deep sequencing
73321 reads, 196 reads per million, 106 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chrX: 113074824-113074893 [-]
sense
OTTMUST00000044723 ; Chm-002; intron 8
OTTMUST00000044722 ; Chm-001; intron 9
OTTMUST00000044724 ; Chm-003; intron 9
ENSMUST00000113388 ; Chm-002; intron 8
ENSMUST00000026607 ; Chm-001; intron 9
ENSMUST00000135821 ; Chm-003; intron 9
Database links

Mature sequence mmu-miR-361-5p

Accession MIMAT0000704
Previous IDsmmu-miR-361
Sequence

6 - 

uuaucagaaucuccagggguac

 - 27

Get sequence
Deep sequencing63246 reads, 106 experiments
Evidence experimental; cloned [1-2], Illumina [3,5]
Database links
Predicted targets

Mature sequence mmu-miR-361-3p

Accession MIMAT0017075
Previous IDsmmu-miR-361*
Sequence

43 - 

ucccccaggugugauucugauuugu

 - 67

Get sequence
Deep sequencing10075 reads, 103 experiments
Evidence experimental; 454 [4], Illumina [5]
Database links
Predicted targets

References

1
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).