Stem-loop sequence mmu-mir-217

Accession

MI0000731 (change log)

Symbol

MGI:Mir217

Description

Mus musculus miR-217 stem-loop

Gene family

MIPF0000077; mir-217

Literature search

34 open access papers mention mmu-mir-217
(228 sentences)

Stem-loop

   aaacauagucauuaca    uu       c  a  c     c         -cu    aag 
5'                 guuu  gauguug ag ua ugcau aggaacuga   ggau   a
                   ||||  ||||||| || || ||||| |||||||||   ||||    
3'                 caaa  cuacgac uc gu acgua uccuugacu   ccua   c
   --------------aa    -u       u  c  u     a         acc    auu 

Deep sequencing

60181 reads, 244 reads per million, 57 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

This miRNA was predicted by computational methods using conservation in with human, mouse and Fugu rubripes [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. The mature mouse and human (MI0000293) sequences differ at a single position [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies in mouse [3].

Genome context

• Coordinates (GRCm38; GCA_000001635.2): chr11: 28763728-28763835 [+]
• Overlapping transcripts:

  sense

  OTTMUST00000011841 ; RP23-298H6.1-001; intron 2

  ENSMUST00000138164 ; Gm12082-001; intron 2

Clustered miRNAs

< 10kb from mmu-mir-217

• mmu-mir-216a: chr11: 28757012-28757083 [+]
• mmu-mir-217: chr11: 28763728-28763835 [+]

Database links

• EntrezGene:Mirn217
• MGI:Mir217
• RNAcentral:URS000075D32D_10090
• miRBase Tracker:MI0000731

Mature sequence mmu-miR-217-5p

• Accession: MIMAT0000679
• Previous IDs: mmu-miR-217
• Sequence: 34 - uacugcaucaggaacugacugga - 56
• Deep sequencing: 59988 reads, 56 experiments
• Evidence: experimental; cloned [3], Illumina [4,6]
• Database links:
  • RNAcentral:URS000010BB67_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-217-5p
  • miRDB:mmu-miR-217-5p
  • microrna.org:mmu-miR-217-5p

Mature sequence mmu-miR-217-3p

• Accession: MIMAT0017072
• Previous IDs: mmu-miR-217*
• Sequence: 71 - caucaguuccuaaugcauugccu - 93
• Deep sequencing: 192 reads, 11 experiments
• Evidence: experimental; 454 [5], Illumina [6]
• Database links:
  • RNAcentral:URS00001B323C_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-217-3p
  • miRDB:mmu-miR-217-3p

References

1. PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2. PMID:15634332 "New human and mouse microRNA genes found by homology search" Weber MJ FEBS J. 272:59-73(2005).
3. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4. PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5. PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
6. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).