![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-224 |
||||||
Accession | MI0000711 (change log) | |||||
Symbol | MGI:Mir224 | |||||
Description | Mus musculus miR-224 stem-loop | |||||
Gene family | MIPF0000088; mir-224 | |||||
Literature search |
![]()
44 open access papers mention mmu-mir-224 | |||||
Stem-loop |
ua u u a u ug uu 5' gggcuuu agucacuag ggu ccguuu g aga gu g ||||||| ||||||||| ||| |||||| | ||| || 3' cccgaaa ucagugauc ccg gguaaa c uuu ua u ca - u a - gu cg |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: not enough data
| |||||
Comments |
Mouse mir-224 is predicted [2] based on homology to a cloned miR from human (MI0000301) [1]. Its expression was later verified by cloning [3]. |
|||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence mmu-miR-224-5p |
|
Accession | MIMAT0000671 |
Previous IDs | mmu-miR-224 |
Sequence |
8 - uaagucacuagugguuccguu - 28 |
Deep sequencing | 15692 reads, 86 experiments |
Evidence | experimental; cloned [3], Illumina [4-5] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-224-3p |
|
Accession | MIMAT0017062 |
Previous IDs | mmu-miR-224* |
Sequence |
55 - aaauggugcccuagugacuaca - 76 |
Deep sequencing | 177 reads, 19 experiments |
Evidence | experimental; Illumina [5] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12554860
"Numerous microRNPs in neuronal cells containing novel microRNAs"
RNA. 9:180-186(2003).
|
2 |
PMID:15634332
"New human and mouse microRNA genes found by homology search"
FEBS J. 272:59-73(2005).
|
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
4 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
5 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|