Stem-loop sequence mmu-mir-222

AccessionMI0000710 (change log)
Symbol MGI:Mir222
DescriptionMus musculus miR-222 stem-loop
Gene family MIPF0000051; mir-221
Literature search

123 open access papers mention mmu-mir-222
(1014 sentences)

Stem-loop
   -  c    u              -     auc   ucuu 
5'  cc ucag ggcucaguagccag uguag   cug    u
    || |||| |||||||||||||| |||||   |||    g
3'  gg gguc cugggucaucgguc acauc   gac    g
   c  u    u              u     gac   uaau 
Get sequence
Deep sequencing
520641 reads, 1.63e+03 reads per million, 108 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Mouse mir-222 is predicted [2] based on homology to a reported miR from human (MI0000299) [1]. Its expression was later verified in mouse by cloning [3].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chrX: 19146893-19146971 [-]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-222
mmu-mir-222chrX: 19146893-19146971 [-]
mmu-mir-221chrX: 19146294-19146388 [-]
Database links

Mature sequence mmu-miR-222-5p

Accession MIMAT0017061
Previous IDsmmu-miR-222*
Sequence

11 - 

cucaguagccaguguagaucc

 - 31

Get sequence
Deep sequencing4492 reads, 88 experiments
Evidence experimental; 454 [5], Illumina [6]
Database links
Predicted targets

Mature sequence mmu-miR-222-3p

Accession MIMAT0000670
Previous IDsmmu-miR-222
Sequence

49 - 

agcuacaucuggcuacugggucu

 - 71

Get sequence
Deep sequencing516129 reads, 108 experiments
Evidence experimental; cloned [3], Illumina [4,6]
Database links
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
6
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).