Stem-loop sequence mmu-mir-221

AccessionMI0000709 (change log)
Symbol MGI:Mir221
DescriptionMus musculus miR-221 stem-loop
Gene family MIPF0000051; mir-221
Literature search

197 open access papers mention mmu-mir-221
(1425 sentences)

Stem-loop
   a       cugg   a    -  ug   u         auuu    -   u 
5'  uccaggu    ggc ugaa cc  gca acaauguag    cugu guu g
    |||||||    ||| |||| ||  ||| |||||||||    |||| ||| u
3'  aggucca    ucg acuu gg  cgu uguuacauc    gaca cgg u
   a       ----   g    u  gu   c         ----    a   a 
Get sequence
Deep sequencing
1200021 reads, 2.5e+03 reads per million, 108 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Mouse mir-221 is predicted [2] based on homology to a reported miR from human (MI0000298) [1]. Its expression was later verified by cloning [3].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chrX: 19146294-19146388 [-]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-221
mmu-mir-222chrX: 19146893-19146971 [-]
mmu-mir-221chrX: 19146294-19146388 [-]
Database links

Mature sequence mmu-miR-221-5p

Accession MIMAT0017060
Previous IDsmmu-miR-221*
Sequence

20 - 

accuggcauacaauguagauuucugu

 - 45

Get sequence
Deep sequencing33185 reads, 101 experiments
Evidence experimental; 454 [5], Illumina [6]
Database links
Predicted targets

Mature sequence mmu-miR-221-3p

Accession MIMAT0000669
Previous IDsmmu-miR-221
Sequence

60 - 

agcuacauugucugcuggguuuc

 - 82

Get sequence
Deep sequencing1166826 reads, 107 experiments
Evidence experimental; cloned [3], Illumina [4,6]
Database links
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
6
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).