Stem-loop sequence mmu-mir-33

AccessionMI0000707 (change log)
Symbol MGI:Mir33
DescriptionMus musculus miR-33 stem-loop
Gene family MIPF0000070; mir-33
Literature search

61 open access papers mention mmu-mir-33
(805 sentences)

Stem-loop 
                 a uu         guucu  c 
5' cuguggugcauugu g  gcauugcau     gg a
   |||||||||||||| |  |||||||||     || a
3' ggcacuacgugaca c  uguaacgug     cc u
                 c uu         ----u  a
Get sequence
Deep sequencing
71711 reads, 394 reads per million, 105 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Mouse mir-33 is predicted [2] based on homology to a cloned miR from human (MI0000091) [1]. Its expression was later verified by cloning [3].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr15: 82198122-82198190 [+]
sense
ENSMUST00000023100 ; Srebf2-201; intron 16
Database links

Mature sequence mmu-miR-33-5p

Accession MIMAT0000667
Previous IDsmmu-miR-33
Sequence

6 -  

gugcauuguaguugcauugca

 - 26

Get sequence
Deep sequencing70462 reads, 104 experiments
Evidence experimental; cloned [3], Illumina [4-5]
Database links
Predicted targets

Mature sequence mmu-miR-33-3p

Accession MIMAT0004666
Previous IDsmmu-miR-33*
Sequence

46 -  

caauguuuccacagugcaucac

 - 67

Get sequence
Deep sequencing1131 reads, 87 experiments
Evidence experimental; cloned [3], Illumina [4-5]
Database links
Predicted targets

References

1
PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2
PMID:15634332 "New human and mouse microRNA genes found by homology search" Weber MJ FEBS J. 272:59-73(2005).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).