![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-212 |
||||||
Accession | MI0000696 (change log) | |||||
Symbol | MGI:Mir212 | |||||
Description | Mus musculus miR-212 stem-loop | |||||
Gene family | MIPF0000065; mir-132 | |||||
Literature search |
![]()
76 open access papers mention mmu-mir-212 | |||||
Stem-loop |
- c c -ca u cu c ccc g 5' gggc ag gcg cgg cc uggcu agacug uuacug gg c |||| || ||| ||| || ||||| |||||| |||||| || 3' cccg uc cgc gcc gg acuga ucugac aaugac cc c g - a acc c cc - -uu g |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: high
| |||||
Comments |
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. |
|||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence mmu-miR-212-5p |
|
Accession | MIMAT0017053 |
Sequence |
16 - accuuggcucuagacugcuuacu - 38 |
Deep sequencing | 17682 reads, 99 experiments |
Evidence | experimental; Illumina [5] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-212-3p |
|
Accession | MIMAT0000659 |
Previous IDs | mmu-miR-212 |
Sequence |
56 - uaacagucuccagucacggcca - 77 |
Deep sequencing | 11753 reads, 99 experiments |
Evidence | experimental; cloned [3], Illumina [4-5] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12624257
"Vertebrate microRNA genes"
Science. 299:1540(2003).
|
2 |
PMID:15634332
"New human and mouse microRNA genes found by homology search"
FEBS J. 272:59-73(2005).
|
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
4 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
5 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|