Stem-loop sequence rno-mir-101b

Accession

MI0000648 (change log)

Description

Rattus norvegicus miR-101b stem-loop

Gene family

MIPF0000046; mir-101

Literature search

22 open access papers mention rno-mir-101b
(174 sentences)

Stem-loop

   aucugagac  -a  ug  c                    c a    --g  g 
5'          ug  ac  uc uuuuucgguuaucaugguac g ugcu   ua a
            ||  ||  || |||||||||||||||||||| | ||||   ||  
3'          ac  ug  gg aagaagucgauagugucaug c augg   gu u
   -------cu  cg  gu  u                    a -    aaa  c 

Deep sequencing

3359623 reads, 2.77e+03 reads per million, 513 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context

• Coordinates (Rnor_6.0; GCA_000001895.4): chr1: 247263723-247263819 [+]
• Overlapping transcripts:

  sense

  ENSRNOT00000020809 ; Rcl1-202; intron 4

  ENSRNOT00000048910 ; Rcl1-201; intron 9

Database links

• EntrezGene:Mir101b
• miRBase Tracker:MI0000648

Mature sequence rno-miR-101b-5p

• Accession: MIMAT0017045
• Previous IDs: rno-miR-101b*
• Sequence: 24 - ucgguuaucaugguaccgaugc - 45
• Deep sequencing: 111 reads, 69 experiments
• Evidence: experimental; SOLiD [5]
• Predicted targets:
  • TargetScanVert:rno-miR-101b-5p
  • miRDB:rno-miR-101b-5p

Mature sequence rno-miR-101b-3p

• Accession: MIMAT0000615
• Previous IDs: rno-miR-101b
• Sequence: 61 - uacaguacugugauagcugaa - 81
• Deep sequencing: 3359467 reads, 513 experiments
• Evidence: experimental; cloned [1-4], SOLiD [5]
• Predicted targets:
  • TargetScanVert:rno-miR-101b-3p
  • miRDB:rno-miR-101b-3p
  • microrna.org:rno-miR-101b-3p

References

1. PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2. PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
3. PMID:16766679 "Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes" Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H Genes Dev. 20:1732-1743(2006).
4. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5. PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).