Stem-loop sequence rno-mir-135b

AccessionMI0000645 (change log)
DescriptionRattus norvegicus miR-135b stem-loop
Gene family MIPF0000028; mir-135
Literature search

21 open access papers mention rno-mir-135b
(39 sentences)

Stem-loop 
   ------c     --                   cau          uug ug 
5'        gcucu  gcuguggccuauggcuuuu   uccuauguga   c  u
          |||||  |||||||||||||||||||   ||||||||||   |   
3'        cgggg  ugacaucggguaccgaaaa   gggauguacu   g  u
   ccucgaa     ag                   -uc          caa cc
Get sequence
Deep sequencing
42585 reads, 30 reads per million, 317 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr13: 48976986-48977082 [+]
intergenic
Database links

Mature sequence rno-miR-135b-5p

Accession MIMAT0000611
Previous IDsrno-miR-135b
Sequence

16 -  

uauggcuuuucauuccuauguga

 - 38

Get sequence
Deep sequencing42116 reads, 313 experiments
Evidence experimental; cloned [1-2], SOLiD [3]
Predicted targets

Mature sequence rno-miR-135b-3p

Accession MIMAT0017043
Previous IDsrno-miR-135b*
Sequence

55 -  

auguagggcuaaaagccauggg

 - 76

Get sequence
Deep sequencing465 reads, 84 experiments
Evidence experimental; SOLiD [3]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).