Stem-loop sequence mmu-mir-350

Accession

MI0000640 (change log)

Symbol

MGI:Mir350

Description

Mus musculus miR-350 stem-loop

Gene family

MIPF0000245; mir-350

Literature search

9 open access papers mention mmu-mir-350
(36 sentences)

Stem-loop

   agaugccuug      c   a  -      c   c      -     gugag 
5'           cuccua aag gu aaagug aug gcuuug ggaca     g
             |||||| ||| || |||||| ||| |||||| |||||     a
3'           gaggau uuc ca uuucac uac cgaaac cuugu     a
   -----guuga      -   c  c      a   c      a     aauaa 

Deep sequencing

38325 reads, 189 reads per million, 106 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. This mouse miRNA is predicted based on homology to the verified rat sequence (MI0000639) - its expression was later independently verified in mouse [2]. The sequence reported in [1] contains a 5' terminal A residue, which conflicts with the precursor sequence shown here. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context

• Coordinates (GRCm38; GCA_000001635.2): chr1: 176772325-176772423 [-]
• Overlapping transcripts:

  sense

  ENSMUST00000057037 ; Cep170-201; intron 8

Database links

• EntrezGene:Mirn350
• MGI:Mir350
• RNAcentral:URS00006E0462_10090
• miRBase Tracker:MI0000640

Mature sequence mmu-miR-350-5p

• Accession: MIMAT0017040
• Previous IDs: mmu-miR-350*
• Sequence: 24 - aaagugcaugcgcuuuggg - 42
• Deep sequencing: 3912 reads, 97 experiments
• Evidence: experimental; 454 [5], Illumina [6]
• Database links:
  • RNAcentral:URS0000388339_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-350-5p
  • miRDB:mmu-miR-350-5p

Mature sequence mmu-miR-350-3p

• Accession: MIMAT0000605
• Previous IDs: mmu-miR-350
• Sequence: 61 - uucacaaagcccauacacuuuc - 82
• Deep sequencing: 34406 reads, 106 experiments
• Evidence: experimental; cloned [2-3], Illumina [4,6]
• Database links:
  • RNAcentral:URS00002B4DBC_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-350-3p
  • miRDB:mmu-miR-350-3p
  • microrna.org:mmu-miR-350-3p

References

1. PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2. PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
3. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4. PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5. PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
6. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).