![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence rno-mir-20a |
||||||||||||||
Accession | MI0000638 (change log) | |||||||||||||
Previous IDs | rno-mir-20 | |||||||||||||
Description | Rattus norvegicus miR-20a stem-loop | |||||||||||||
Gene family | MIPF0000001; mir-17 | |||||||||||||
Literature search |
![]()
49 open access papers mention rno-mir-20a | |||||||||||||
Stem-loop |
ucu c -a ua g u u 5' cagcu guag acu aagugcu uagugcag uag gug c ||||| |||| ||| ||||||| |||||||| ||| ||| 3' gucga cguc uga uucacga auuacguc auc uac g --c a ca gc - - u |
|||||||||||||
Deep sequencing |
| |||||||||||||
Confidence |
Annotation confidence: high
| |||||||||||||
Genome context |
|
|||||||||||||
Clustered miRNAs |
|
|||||||||||||
Database links |
Mature sequence rno-miR-20a-5p |
|
Accession | MIMAT0000602 |
Previous IDs | rno-miR-20;rno-miR-20a |
Sequence |
16 - uaaagugcuuauagugcagguag - 38 |
Deep sequencing | 68169 reads, 492 experiments |
Evidence | experimental; cloned [1-3], SOLiD [4] |
Predicted targets |
|
Mature sequence rno-miR-20a-3p |
|
Accession | MIMAT0000603 |
Previous IDs | rno-miR-20*;rno-miR-20a* |
Sequence |
52 - acugcauuacgagcacuuaca - 72 |
Deep sequencing | 483 reads, 222 experiments |
Evidence | experimental; cloned [1], SOLiD [4] |
Predicted targets |
|
References |
|
1 |
PMID:14691248
"Identification of many microRNAs that copurify with polyribosomes in mammalian neurons"
Proc Natl Acad Sci U S A. 101:360-365(2004).
|
2 | |
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
4 |
PMID:20403161
"Small RNA expression and strain specificity in the rat"
BMC Genomics. 11:249(2010).
|