Stem-loop sequence rno-mir-346

AccessionMI0000633 (change log)
DescriptionRattus norvegicus miR-346 stem-loop
Gene family MIPF0000188; mir-346
Literature search

6 open access papers mention rno-mir-346
(10 sentences)

Stem-loop 
   -----------     g ug    u    cu    g   g        u  guug 
5'            ucugu u  ggca cugu  gccu agu ccugccuc cu    c
              ||||| |  |||| ||||  |||| ||| |||||||| ||     
3'            agacg g  ccgu gacg  cggg ucg ggacggag ga    u
   cuuccucgucg     - gu    c    uc    -   g        -  aguc
Get sequence
Deep sequencing
18812 reads, 6.57 reads per million, 289 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. The sequence reported in [1] contains two 3' terminal A residues, which conflict with the precursor sequence shown here.

Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr16: 11250054-11250151 [+]
intergenic
Database links

Mature sequence rno-miR-346

Accession MIMAT0000596
Sequence

16 -  

ugucugccugagugccugccucu

 - 38

Get sequence
Deep sequencing18563 reads, 232 experiments
Evidence experimental; cloned [1-2], SOLiD [3]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).