![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence rno-mir-345 |
|||||
Accession | MI0000631 (change log) | ||||
Description | Rattus norvegicus miR-345 stem-loop | ||||
Gene family | MIPF0000189; mir-345 | ||||
Literature search |
![]()
6 open access papers mention rno-mir-345 | ||||
Stem-loop |
--------acc gu c g u c u - 5' caa ccagg cu c gaccccuagu cag gcuu guggu ||| ||||| || | |||||||||| ||| |||| |||| g 3' guu ggucc ga g cuggggauca guc cggg caucg ggacaccucua ug a g u a c u |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
Mature sequence rno-miR-345-5p |
|
Accession | MIMAT0000594 |
Previous IDs | rno-miR-345 |
Sequence |
16 - ugcugaccccuaguccagugc - 36 |
Deep sequencing | 21990 reads, 485 experiments |
Evidence | experimental; cloned [1-3], Northern [1], SOLiD [5] |
Predicted targets |
|
Mature sequence rno-miR-345-3p |
|
Accession | MIMAT0004655 |
Sequence |
54 - cccugaacuaggggucuggaga - 75 |
Deep sequencing | 23160 reads, 482 experiments |
Evidence | experimental; cloned [4], SOLiD [5] |
Predicted targets |
|
References |
|
1 |
PMID:14691248
"Identification of many microRNAs that copurify with polyribosomes in mammalian neurons"
Proc Natl Acad Sci U S A. 101:360-365(2004).
|
2 |
PMID:15345052
"Microarray analysis of microRNA expression in the developing mammalian brain"
Genome Biol. 5:R68(2004).
|
3 | |
4 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
5 |
PMID:20403161
"Small RNA expression and strain specificity in the rat"
BMC Genomics. 11:249(2010).
|