Stem-loop sequence rno-mir-336

AccessionMI0000613 (change log)
DescriptionRattus norvegicus miR-336 stem-loop
Literature search

1 open access papers mention rno-mir-336
(1 sentences)

Stem-loop 
   --------au  ga   u     u  -      --cau         - ugag 
5'           gu  ccg gccuc ca cccuuc     aucuagucu c    a
             ||  ||| ||||| || ||||||     ||||||||| |     
3'           ca  ggu cggag gu gggaag     uaggucaga g    a
   auuucgaggu  aa   c     u  a      uaccu         a uaaa
Get sequence
Deep sequencing
29 reads, 0 reads per million, 25 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1].

Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr10: 35349756-35349851 [+]
sense
ENSRNOT00000003987 ; Mapk9-201; intron 1
ENSRNOT00000004010 ; Mapk9-202; intron 1
Database links

Mature sequence rno-miR-336-5p

Accession MIMAT0000576
Previous IDsrno-miR-336
Sequence

16 -  

ucacccuuccauaucuagucu

 - 36

Get sequence
Deep sequencing21 reads, 19 experiments
Evidence experimental; cloned [1], SOLiD [2]
Predicted targets

Mature sequence rno-miR-336-3p

Accession MIMAT0017034
Previous IDsrno-miR-336*
Sequence

52 -  

acuggauuccaugaagggauguga

 - 75

Get sequence
Deep sequencing3 reads, 3 experiments
Evidence experimental; SOLiD [2]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).