Stem-loop sequence mmu-mir-331

Accession

MI0000609 (change log)

Symbol

MGI:Mir331

Description

Mus musculus miR-331 stem-loop

Gene family

MIPF0000199; mir-331

Literature search

24 open access papers mention mmu-mir-331
(147 sentences)

Stem-loop

   gagucu  uuuu         u        u    u       au ccaga 
5'       gg    guuuggguu guucuagg augg cccaggg  c     u
         ||    ||||||||| |||||||| |||| |||||||  |     c
3'       cc    caaauccaa caagaucc uauc ggguccc  g     a
   ----ug  ----         c        -    c       cg accaa 

Deep sequencing

35416 reads, 135 reads per million, 106 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCm38; GCA_000001635.2): chr10: 93963768-93963863 [-]
• Overlapping transcripts:

  sense

  OTTMUST00000076728 ; Vezt-011; intron 2

  OTTMUST00000076692 ; Vezt-001; 3'UTR (exon 12)

  ENSMUST00000148450 ; Vezt-011; intron 2

  ENSMUST00000119818 ; Vezt-001; 3'UTR (exon 12)

Database links

• EntrezGene:Mirn331
• MGI:Mir331
• RNAcentral:URS000075B3F5_10090
• miRBase Tracker:MI0000609

Mature sequence mmu-miR-331-5p

• Accession: MIMAT0004643
• Sequence: 26 - cuagguauggucccagggaucc - 47
• Deep sequencing: 1245 reads, 86 experiments
• Evidence: experimental; cloned [1], Illumina [2-3]
• Database links:
  • RNAcentral:URS00001597DC_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-331-5p
  • miRDB:mmu-miR-331-5p
  • microrna.org:mmu-miR-331-5p

Mature sequence mmu-miR-331-3p

• Accession: MIMAT0000571
• Previous IDs: mmu-miR-331
• Sequence: 61 - gccccugggccuauccuagaa - 81
• Deep sequencing: 33818 reads, 105 experiments
• Evidence: experimental; cloned [1], Illumina [2-3]
• Database links:
  • RNAcentral:URS00003DDE27_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-331-3p
  • miRDB:mmu-miR-331-3p
  • microrna.org:mmu-miR-331-3p

References

1. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2. PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
3. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).