![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence rno-mir-331 |
|||||
Accession | MI0000608 (change log) | ||||
Description | Rattus norvegicus miR-331 stem-loop | ||||
Gene family | MIPF0000199; mir-331 | ||||
Literature search |
![]()
7 open access papers mention rno-mir-331 | ||||
Stem-loop |
gaguc ucuu u u u au ccaga 5' ugg guuuggguu guucuagg augg cccaggg c u ||| ||||||||| |||||||| |||| ||||||| | c 3' acc caaauccaa caagaucc uauc ggguccc g a ----u ---- c - c cg accaa |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Comments |
Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. This rat miRNA has a predicted homologue in mouse (MI0000609). |
||||
Genome context |
|
||||
Database links |
Mature sequence rno-miR-331-5p |
|
Accession | MIMAT0017033 |
Previous IDs | rno-miR-331* |
Sequence |
7 - ggucuuguuuggguuuguu - 25 |
Deep sequencing | 462 reads, 215 experiments |
Evidence | experimental; SOLiD [2] |
Predicted targets |
|
Mature sequence rno-miR-331-3p |
|
Accession | MIMAT0000570 |
Previous IDs | rno-miR-331 |
Sequence |
61 - gccccugggccuauccuagaa - 81 |
Deep sequencing | 72424 reads, 484 experiments |
Evidence | experimental; cloned [1], Northern [1], SOLiD [2] |
Predicted targets |
|
References |
|
1 |
PMID:14691248
"Identification of many microRNAs that copurify with polyribosomes in mammalian neurons"
Proc Natl Acad Sci U S A. 101:360-365(2004).
|
2 |
PMID:20403161
"Small RNA expression and strain specificity in the rat"
BMC Genomics. 11:249(2010).
|