Stem-loop sequence rno-mir-330

AccessionMI0000606 (change log)
DescriptionRattus norvegicus miR-330 stem-loop
Gene family MIPF0000200; mir-330
Literature search

14 open access papers mention rno-mir-330
(35 sentences)

Stem-loop 
   acccuuu   -  u u           --    -    u   ag    uucaa 
5'        ggc ga c cugccucucug  ggcc ugug cuu  gcuc     g
          ||| || | |||||||||||  |||| |||| |||  ||||     a
3'        ucg cu g gauggagagac  ccgg acac gaa  cgag     u
   ------c   u  c c           gu    g    -   -a    caauc
Get sequence
Deep sequencing
254030 reads, 124 reads per million, 493 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature miRNA originating from the 3' arm reported in [1] contains an extra 3' A residue, which conflicts with the precursor sequence shown here. Landgraf et al. show that the 5' miRNA is the predominant one [2]. The 3' mature sequence is renamed miR-300* here.

Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr1: 80092681-80092777 [+]
sense
ENSRNOT00000041215 ; Eml2-201; intron 4
Database links

Mature sequence rno-miR-330-5p

Accession MIMAT0004641
Previous IDsrno-miR-330
Sequence

21 -  

ucucugggccugugucuuaggc

 - 42

Get sequence
Deep sequencing216160 reads, 492 experiments
Evidence experimental; cloned [2], SOLiD [3]
Predicted targets

Mature sequence rno-miR-330-3p

Accession MIMAT0000568
Previous IDsrno-miR-330;rno-miR-330*
Sequence

60 -  

gcaaagcacagggccugcagaga

 - 82

Get sequence
Deep sequencing37642 reads, 435 experiments
Evidence experimental; cloned [1], SOLiD [3]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).