Stem-loop sequence rno-mir-325

Accession

MI0000596 (change log)

Description

Rattus norvegicus miR-325 stem-loop

Gene family

MIPF0000147; mir-325

Literature search

11 open access papers mention rno-mir-325
(19 sentences)

Stem-loop

   ----------a              cc   u                uu gug 
5'            uauagugcuugguu  uag aggugcucaguaagug  u   a
              ||||||||||||||  ||| ||||||||||||||||  |    
3'            gugucacgaacuaa  auc uccacgaguuauuugc  a   c
   ggucucggauc              cu   c                uu aua 

Deep sequencing

36802 reads, 7.84 reads per million, 319 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Rnor_6.0; GCA_000001895.4): chrX: 76334271-76334368 [-]
• Overlapping transcripts:

  intergenic

Database links

• EntrezGene:Mir325
• miRBase Tracker:MI0000596

Mature sequence rno-miR-325-5p

• Accession: MIMAT0000557
• Previous IDs: rno-miR-325
• Sequence: 16 - ccuaguaggugcucaguaagugu - 38
• Deep sequencing: 18214 reads, 268 experiments
• Evidence: experimental; cloned [1-2], SOLiD [4]
• Predicted targets:
  • TargetScanVert:rno-miR-325-5p
  • miRDB:rno-miR-325-5p
  • microrna.org:rno-miR-325-5p

Mature sequence rno-miR-325-3p

• Accession: MIMAT0004639
• Sequence: 54 - uuuauugagcaccuccuaucaa - 75
• Deep sequencing: 18579 reads, 271 experiments
• Evidence: experimental; cloned [3], SOLiD [4]
• Predicted targets:
  • TargetScanVert:rno-miR-325-3p
  • miRDB:rno-miR-325-3p
  • microrna.org:rno-miR-325-3p

References

1. PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2. PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
3. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4. PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).