Stem-loop sequence mmu-mir-21a

Accession

MI0000569 (change log)

Previous IDs

mmu-mir-21

Symbol

MGI:Mir21a

Description

Mus musculus miR-21 stem-loop

Gene family

MIPF0000060; mir-21

Literature search

663 open access papers mention mmu-mir-21a
(6556 sentences)

Stem-loop

   u      ccu                a     a     a    u a 
5'  guacca   ugucggauagcuuauc gacug uguug cugu g a
    ||||||   |||||||||||||||| ||||| ||||| |||| | u
3'  uauggu   acagucugucggguag cugac acaac ggua c c
   c      uuu                -     g     -    - u 

Deep sequencing

13749173 reads, 3.84e+04 reads per million, 107 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCm38; GCA_000001635.2): chr11: 86584067-86584158 [-]
• Overlapping transcripts:

  sense

  OTTMUST00000002400 ; Vmp1-001; 3'UTR (exon 12)

  ENSMUST00000018315 ; Vmp1-001; 3'UTR (exon 12)

Database links

• EntrezGene:Mirn21
• MGI:Mir21a
• RNAcentral:URS000075A91E_10090
• miRBase Tracker:MI0000569

Mature sequence mmu-miR-21a-5p

• Accession: MIMAT0000530
• Previous IDs: mmu-miR-21;mmu-miR-21-5p
• Sequence: 18 - uagcuuaucagacugauguuga - 39
• Deep sequencing: 13686190 reads, 107 experiments
• Evidence: experimental; cloned [1-2,4-6], Northern [2], Illumina [8]
• Database links:
  • RNAcentral:URS000039ED8D_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-21a-5p
  • miRDB:mmu-miR-21a-5p
  • microrna.org:mmu-miR-21a-5p

Mature sequence mmu-miR-21a-3p

• Accession: MIMAT0004628
• Previous IDs: mmu-miR-21*;mmu-miR-21-3p
• Sequence: 56 - caacagcagucgaugggcuguc - 77
• Deep sequencing: 58114 reads, 105 experiments
• Evidence: experimental; cloned [6], Illumina [8-9]
• Database links:
  • RNAcentral:URS000015930E_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-21a-3p
  • miRDB:mmu-miR-21a-3p
  • microrna.org:mmu-miR-21a-3p

References

1. PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2. PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
3. PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
4. PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
5. PMID:16766679 "Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes" Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H Genes Dev. 20:1732-1743(2006).
6. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
7. PMID:17687032 "Competing interactions between micro-RNAs determine neural progenitor survival and proliferation after ethanol exposure: evidence from an ex vivo model of the fetal cerebral cortical neuroepithelium" Sathyan P, Golden HB, Miranda RC J Neurosci. 27:8546-8557(2007).
8. PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
9. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).