![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-let-7e |
||||||||
Accession | MI0000561 (change log) | |||||||
Symbol | MGI:Mirlet7e | |||||||
Description | Mus musculus let-7e stem-loop | |||||||
Gene family | MIPF0000002; let-7 | |||||||
Literature search |
![]()
430 open access papers mention mmu-let-7e | |||||||
Stem-loop |
c cc c cu g u ggaaga ac 5' gcgc cc ggg gag uaggagguuguauagu ga c c |||| || ||| ||| |||||||||||||||| || | 3' cgcg gg ccc uuc auccuccggcauauca cu g c c uc a cu g - --agag ag |
|||||||
Deep sequencing |
| |||||||
Confidence |
Annotation confidence: high
| |||||||
Comments |
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. |
|||||||
Genome context |
|
|||||||
Clustered miRNAs |
|
|||||||
Database links |
|
Mature sequence mmu-let-7e-5p |
|
Accession | MIMAT0000524 |
Previous IDs | mmu-let-7e |
Sequence |
15 - ugagguaggagguuguauaguu - 36 |
Deep sequencing | 51249173 reads, 109 experiments |
Evidence | experimental; cloned [1-4], Illumina [5,7] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-let-7e-3p |
|
Accession | MIMAT0017016 |
Previous IDs | mmu-let-7e* |
Sequence |
60 - cuauacggccuccuagcuuucc - 81 |
Deep sequencing | 3863 reads, 77 experiments |
Evidence | experimental; 454 [6], Illumina [7] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12007417
"Identification of tissue-specific microRNAs from mouse"
Curr Biol. 12:735-739(2002).
|
2 |
PMID:15538371
"A pancreatic islet-specific microRNA regulates insulin secretion"
Nature. 432:226-230(2004).
|
3 | |
4 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
5 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
6 |
PMID:20668074
"Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68"
J Virol. 84:10266-10275(2010).
|
7 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|