Stem-loop sequence mmu-let-7e

AccessionMI0000561 (change log)
Symbol MGI:Mirlet7e
DescriptionMus musculus let-7e stem-loop
Gene family MIPF0000002; let-7
Literature search

430 open access papers mention mmu-let-7e
(2159 sentences)

Stem-loop
   c    cc  c   cu   g                u  ggaaga ac 
5'  gcgc  cc ggg  gag uaggagguuguauagu ga      c  c
    ||||  || |||  ||| |||||||||||||||| ||      |   
3'  cgcg  gg ccc  uuc auccuccggcauauca cu      g  c
   c    uc  a   cu   g                -  --agag ag 
Get sequence
Deep sequencing
51253163 reads, 9.65e+04 reads per million, 109 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr17: 17830352-17830444 [+]
antisense
ENSMUST00000175058 ; Gm25927-201; exon 1
Clustered miRNAs
< 10kb from mmu-let-7e
mmu-mir-99bchr17: 17830188-17830257 [+]
mmu-let-7echr17: 17830352-17830444 [+]
mmu-mir-125achr17: 17830812-17830879 [+]
Database links

Mature sequence mmu-let-7e-5p

Accession MIMAT0000524
Previous IDsmmu-let-7e
Sequence

15 - 

ugagguaggagguuguauaguu

 - 36

Get sequence
Deep sequencing51249173 reads, 109 experiments
Evidence experimental; cloned [1-4], Illumina [5,7]
Database links
Predicted targets

Mature sequence mmu-let-7e-3p

Accession MIMAT0017016
Previous IDsmmu-let-7e*
Sequence

60 - 

cuauacggccuccuagcuuucc

 - 81

Get sequence
Deep sequencing3863 reads, 77 experiments
Evidence experimental; 454 [6], Illumina [7]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
3
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
6
PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
7
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).