![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-30d |
||||||
Accession | MI0000549 (change log) | |||||
Symbol | MGI:Mir30d | |||||
Description | Mus musculus miR-30d stem-loop | |||||
Gene family | MIPF0000005; mir-30 | |||||
Literature search |
![]()
194 open access papers mention mmu-mir-30d | |||||
Stem-loop |
a u u u ccc guaa c 5' aguc gug c guaaacauc gacuggaagcu gc a |||| ||| | ||||||||| ||||||||||| || 3' ucgg cau g cguuuguag cugacuuucga cg c c u c u --a --ac a |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: high
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence mmu-miR-30d-5p |
|
Accession | MIMAT0000515 |
Previous IDs | mmu-miR-30d |
Sequence |
12 - uguaaacauccccgacuggaag - 33 |
Deep sequencing | 8070908 reads, 107 experiments |
Evidence | experimental; cloned [1,3-5], Illumina [6,8] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-30d-3p |
|
Accession | MIMAT0017011 |
Previous IDs | mmu-miR-30d* |
Sequence |
52 - cuuucagucagauguuugcugc - 73 |
Deep sequencing | 555974 reads, 106 experiments |
Evidence | experimental; 454 [7], Illumina [8] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12007417
"Identification of tissue-specific microRNAs from mouse"
Curr Biol. 12:735-739(2002).
|
2 |
PMID:12554860
"Numerous microRNPs in neuronal cells containing novel microRNAs"
RNA. 9:180-186(2003).
|
3 |
PMID:15538371
"A pancreatic islet-specific microRNA regulates insulin secretion"
Nature. 432:226-230(2004).
|
4 | |
5 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
6 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
7 |
PMID:20668074
"Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68"
J Virol. 84:10266-10275(2010).
|
8 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|